HUGE

Gene/Protein Characteristic Table for KIAA0855

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00660
Accession No. :	AB020662
Description :	Golgin subfamily A member 8A/B.
HUGO Gene Name :
Clone Name :	hk06219 [Vector Info]
Flexi ORF Clone :	pF1KSDA0855
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4241 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2340 bp

Genome contig ID gi51511731r_32358564
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TGCTACTGTAATGCAATAAATTTTTAAATTGTTGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAGTGCTGTTTTTGCCTTAAAATTTTATTTTGCGTGTCTTGAAAACTAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 r 32458564 32466537 15 99.2 Perfect prediction

ContigView(URL based/DAS) 15 r 32604778 32612758 15 98.0 Perfect prediction

Features of the protein sequence	Description

Length: 632 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAI50330	2.8e-177	100.0	GOLGA8A protein...	Homo sapiens
A7E2F4	5.2e-177	100.0	Golgin subfamil...	Homo sapiens
NP_851422	6.3e-151	98.9	golgi autoantig...	Homo sapiens
A8MQT2	9.4e-151	98.7	Golgin subfamil...	Homo sapiens
AAH93673	3.6e-150	98.5	Golgi autoantig...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AAAGAGGGCAGATATTGGGTC

Primer_r
: GGGCTAGAAATCATACGACTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GGGCTAGAAATCATACGACTG
Primer_r	: AAAGAGGGCAGATATTGGGTC
PCR product length	: 150 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2340 bp
Genome contig ID	gi51511731r_32358564
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TGCTACTGTAATGCAATAAATTTTTAAATTGTTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGTGCTGTTTTTGCCTTAAAATTTTATTTTGCGTGTCTTGAAAACTAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	r	32458564	32466537	15	99.2	Perfect prediction
ContigView(URL based/DAS)	15	r	32604778	32612758	15	98.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0855

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information