HUGE

Gene/Protein Characteristic Table for KIAA0860

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00663
Accession No. :	AB020667
Description :	RING finger protein 37.
HUGO Gene Name :	U-box domain containing 5 (UBOX5)
Clone Name :	hk06518 [Vector Info]
Flexi ORF Clone :	pF1KSDA0860
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4313 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2533 bp

Genome contig ID gi51511747r_2936220
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
CCCTAGAAAATGGGAATAAAATTTCTTTTGCTGTC
Flanking genome sequence
(252305 - 252256)
----+----*----+----*----+----*----+----*----+----*
CCCAGAGTTAATTCTGCCTCCTGGTACCATTTCAGTATTCTATGTGCTGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 r 3019818 3088524 9 98.6 Terminal No-hit

Features of the protein sequence	Description

Length: 551 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O94941	0	100.0	RING finger pro...	Homo sapiens
BAD96596	0	99.8	ubiquitin conju...	Homo sapiens
XP_001160362	0	99.4	U-box domain co...	Pan troglodytes
XP_001115116	0	97.8	U-box domain co...	Macaca mulatta
XP_542922	1.7e-201	89.6	similar to RING...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003613 268 348 PF04564 U box

HMMSmart IPR003613 272 341 SM00504 U box

ProfileScan IPR001841 493 538 PS50089 Zinc finger

ScanRegExp IPR001841 514 523 PS00518 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003613	268	348	PF04564	U box
HMMSmart	IPR003613	272	341	SM00504	U box
ProfileScan	IPR001841	493	538	PS50089	Zinc finger
ScanRegExp	IPR001841	514	523	PS00518	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTCCCTTCTAAGCACGTTTGG

Primer_r
: GTATTGGGTGTGGACTAGAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2533 bp
Genome contig ID	gi51511747r_2936220
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CCCTAGAAAATGGGAATAAAATTTCTTTTGCTGTC
Flanking genome sequence (252305 - 252256)	----+--------+--------+--------+--------+----* CCCAGAGTTAATTCTGCCTCCTGGTACCATTTCAGTATTCTATGTGCTGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	r	3019818	3088524	9	98.6	Terminal No-hit

Primer_f	: TTCCCTTCTAAGCACGTTTGG
Primer_r	: GTATTGGGTGTGGACTAGAGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0860

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information