HUGE

Gene/Protein Characteristic Table for KIAA0869

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07373
Accession No. :	AB020676
Description :	WW domain-containing protein 1.
HUGO Gene Name :	WW and C2 domain containing 1 (WWC1)
Clone Name :	hk06927 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 3408 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 740 bp

Genome contig ID gi51511721f_167665862
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TTTTATCTCCATCAATAAAGTGGCCTTTCAAAAAG
Flanking genome sequence
(163480 - 163529)
----+----*----+----*----+----*----+----*----+----*
AATCTTCCTCTTGCTCTCTTTTTCTTTCCTACCCCTCACTTCATCTGTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 f 167765862 167829340 18 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 888 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW61508	100.0	WW, C2 and coil...	Homo sapiens
AAQ09942	99.9	HBeAg-binding p...	Homo sapiens
EAW61509	99.9	WW, C2 and coil...	Homo sapiens
Q8IX03	99.9	Protein WWC1; W...	Homo sapiens
BAG59017	99.2	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033106	2.9e-22	39.8	KIAA1280

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AATGCCTGGGGGACGGTAATC

Primer_r
: AACACGTCACAGCTCAAGAAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	740 bp
Genome contig ID	gi51511721f_167665862
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TTTTATCTCCATCAATAAAGTGGCCTTTCAAAAAG
Flanking genome sequence (163480 - 163529)	----+--------+--------+--------+--------+----* AATCTTCCTCTTGCTCTCTTTTTCTTTCCTACCCCTCACTTCATCTGTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	f	167765862	167829340	18	99.8	Perfect prediction

Primer_f	: AATGCCTGGGGGACGGTAATC
Primer_r	: AACACGTCACAGCTCAAGAAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0869

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information