HUGE

Gene/Protein Characteristic Table for KIAA0874

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04106
Accession No. :	AB020681
Description :	Ankyrin repeat domain-containing protein 12.
HUGO Gene Name :	ankyrin repeat domain 12 (ANKRD12)
Clone Name :	hk07302 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4440 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2632 bp

Genome contig ID gi51511735f_9147647
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TGCATGTTATTTAATAAAGAGTTATATTTTTATAG
Flanking genome sequence
(126112 - 126161)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAGAGTGAAATGTGTGCTAACTGTTTTTTTACTTAATTTTACTTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 18 f 9247647 9273757 5 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 601 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAS45545	100.0	ankyrin repeat-...	Homo sapiens
CAH56382	100.0	hypothetical pr...	Homo sapiens
AAR25662	100.0	ankyrin repeat-...	Homo sapiens
Q6UB98	100.0	Ankyrin repeat ...	Homo sapiens
XP_001139090	99.8	ankyrin repeat ...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CACTCTCTTAAATGGTACCTC

Primer_r
: TTCAGGCATATACTCCATTCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 18

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CACTCTCTTAAATGGTACCTC
Primer_r	: TTCAGGCATATACTCCATTCC
PCR product length	: 227 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2632 bp
Genome contig ID	gi51511735f_9147647
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TGCATGTTATTTAATAAAGAGTTATATTTTTATAG
Flanking genome sequence (126112 - 126161)	----+--------+--------+--------+--------+----* AAAAAAAGAGTGAAATGTGTGCTAACTGTTTTTTTACTTAATTTTACTTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	18	f	9247647	9273757	5	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA0874

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information