HUGE |
Gene/Protein Characteristic Table for KIAA0877 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00140 |
---|---|
Accession No. : | AB020684 |
Description : | dpy-19-like 1. |
HUGO Gene Name : | dpy-19-like 1 (C. elegans) (DPY19L1) |
Clone Name : | hk07357 [Vector Info] |
Flexi ORF Clone : | pF1KA0877 |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4436 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2692 bp Genome contig ID gi89161213r_34835039 PolyA signal sequence
(ATTAAA,-23) +----*----+----*----+----*----+----
TATATATGTTAAATTAAAAAAAATCATGAGAAATGFlanking genome sequence
(99980 - 99931) ----+----*----+----*----+----*----+----*----+----*
AGGGAAGTGTTTTTCTTGATTGTTATTTTCATTTTCACCTTGATTGTGAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 7 r 34935019 35019750 19 99.4 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 580 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TAGCAGGTTCCATAGGCGTAC | |
: CTTTGCCCATCCTTACTTTCC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 7 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |