HUGE |
Gene/Protein Characteristic Table for KIAA0887 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00674 |
---|---|
Accession No. : | AB020694 |
Description : | UBX domain-containing protein 8. |
HUGO Gene Name : | Fas associated factor family member 2 (FAF2) |
Clone Name : | hk07788 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0887
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4456 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3123 bp Genome contig ID gi51511721f_175708020 PolyA signal sequence
(ATTAAA,-26) +----*----+----*----+----*----+----
TAGGTTAACATTAAATGTTTTATAGCAAAAACTTCFlanking genome sequence
(161662 - 161711) ----+----*----+----*----+----*----+----*----+----*
ATAACAGGCTGTGGATCTTTCTGTGTGGGACCGATGTGGTAGATAATTTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 5 f 175808020 175869680 11 99.3 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 443 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TGACTGAGAAGGAGCGATAAC | |
: ATTTCCGTTGCTGTGTTCCTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 5 |
: GeneBridge 4 | |
: TGACTGAGAAGGAGCGATAAC | |
: ATTTCCGTTGCTGTGTTCCTC | |
: 125 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |