HUGE

Gene/Protein Characteristic Table for KIAA0887

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00674
Accession No. :	AB020694
Description :	UBX domain-containing protein 8.
HUGO Gene Name :	Fas associated factor family member 2 (FAF2)
Clone Name :	hk07788 [Vector Info]
Flexi ORF Clone :	pF1KSDA0887
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4456 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3123 bp

Genome contig ID gi51511721f_175708020
PolyA signal sequence
(ATTAAA,-26)
+----*----+----*----+----*----+----
TAGGTTAACATTAAATGTTTTATAGCAAAAACTTC
Flanking genome sequence
(161662 - 161711)
----+----*----+----*----+----*----+----*----+----*
ATAACAGGCTGTGGATCTTTCTGTGTGGGACCGATGTGGTAGATAATTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 f 175808020 175869680 11 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 443 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96CS3	1.5e-156	100.0	FAS-associated ...	Homo sapiens
XP_546218	3.2e-156	99.8	similar to prot...	Canis lupus fam...
XP_518117	3.6e-156	99.8	UBX domain cont...	Pan troglodytes
XP_001090859	4.1e-156	99.8	similar to UBX ...	Macaca mulatta
XP_001502700	6.1e-156	99.3	UBX domain cont...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000449 10 51 PF00627 Ubiquitin-associated/Translation elongation factor EF1B

IPR001012 354 439 PF00789 UBX

HMMSmart IPR006577 136 261 SM00594 UAS

ProfileScan IPR001012 355 437 PS50033 UBX

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000449	10	51	PF00627	Ubiquitin-associated/Translation elongation factor EF1B
IPR001012	354	439	PF00789	UBX
HMMSmart	IPR006577	136	261	SM00594	UAS
ProfileScan	IPR001012	355	437	PS50033	UBX

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGACTGAGAAGGAGCGATAAC

Primer_r
: ATTTCCGTTGCTGTGTTCCTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGACTGAGAAGGAGCGATAAC
Primer_r	: ATTTCCGTTGCTGTGTTCCTC
PCR product length	: 125 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3123 bp
Genome contig ID	gi51511721f_175708020
PolyA signal sequence (ATTAAA,-26)	+--------+--------+----*----+---- TAGGTTAACATTAAATGTTTTATAGCAAAAACTTC
Flanking genome sequence (161662 - 161711)	----+--------+--------+--------+--------+----* ATAACAGGCTGTGGATCTTTCTGTGTGGGACCGATGTGGTAGATAATTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	f	175808020	175869680	11	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA0887

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information