HUGE

Gene/Protein Characteristic Table for KIAA0911

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB020718
Description :	Calsyntenin-1 precursor.
HUGO Gene Name :	calsyntenin 1 (CLSTN1)
Clone Name :	hj05129 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5218 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
NO NO

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 1480 bp

Genome contig ID gi89161185r_9611673
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
AGTGTATCCGCTACAATAAAGTTCTGGTTCTAACT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACTCCAGCCGGAGCGGGGTTTGTCTTCTCTCCTGTTTTGGTTTTAAACC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 9711673 9807171 19 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1056 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O94985	100.0	Calsyntenin-1; ...	Homo sapiens
XP_001075647	88.4	similar to cals...	Rattus norvegicus
XP_243040	88.7	similar to cals...	Rattus norvegicus
EAW71629	100.0	calsyntenin 1, ...	Homo sapiens
Q9EPL2	92.5	Calsyntenin-1; ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018269	5e-98	52.2	KIAA0726

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002126 198 210 PR00205 Cadherin

IPR002126 218 237 PR00205 Cadherin

IPR002126 237 250 PR00205 Cadherin

IPR002126 290 316 PR00205 Cadherin

HMMPfam IPR002126 117 230 PF00028 Cadherin

IPR002126 244 333 PF00028 Cadherin

HMMSmart IPR002126 134 237 SM00112 Cadherin

IPR002126 260 338 SM00112 Cadherin

ProfileScan IPR002126 113 239 PS50268 Cadherin

IPR002126 240 340 PS50268 Cadherin

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002126	198	210	PR00205	Cadherin
IPR002126	218	237	PR00205	Cadherin
IPR002126	237	250	PR00205	Cadherin
IPR002126	290	316	PR00205	Cadherin
HMMPfam	IPR002126	117	230	PF00028	Cadherin
IPR002126	244	333	PF00028	Cadherin
HMMSmart	IPR002126	134	237	SM00112	Cadherin
IPR002126	260	338	SM00112	Cadherin
ProfileScan	IPR002126	113	239	PS50268	Cadherin
IPR002126	240	340	PS50268	Cadherin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 929 AVVPSTATVVIVVCVSFLVFMII 951 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	929	AVVPSTATVVIVVCVSFLVFMII	951	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTGGTGGCTGTGCTATGTGTG

Primer_r
: ACCAGAACTTTATTGTAGCGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	NO	NO
Warning for coding interruption:	YES	NO

Length of 3'UTR	1480 bp
Genome contig ID	gi89161185r_9611673
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AGTGTATCCGCTACAATAAAGTTCTGGTTCTAACT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACTCCAGCCGGAGCGGGGTTTGTCTTCTCTCCTGTTTTGGTTTTAAACC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	9711673	9807171	19	99.8	Perfect prediction

Primer_f	: CTGGTGGCTGTGCTATGTGTG
Primer_r	: ACCAGAACTTTATTGTAGCGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0911

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information