| HUGE |
Gene/Protein Characteristic Table for KIAA0925 |
|
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00147 |
|---|---|
| Accession No. : | AB023142 |
| Description : | Coronin-2B. |
| HUGO Gene Name : | coronin, actin binding protein, 2B (CORO2B) |
| Clone Name : | hh02949 [Vector Info] |
| Flexi ORF Clone : | pF1KA0925
|
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 3269 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 1828 bp Genome contig ID gi51511731f_66624551 PolyA signal sequence
(AATAAA,-21)
AAGGATAGAATTGAAATAAAATGTTTTCAACTTATFlanking genome sequence
(182646 - 182695)
CAAACCTGGGCATAGCCATCTCATTTAACCCCAGTGGTTCCTGTTCTTGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 15 f 66724542 66807195 11 99.2 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 479 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|
Experimental conditions
| : GAGCTGGGCCTTTCCTTTATG | |
| : AATCACAGAAGACCACAAAGG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 15 |
| : UniGene | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
