HUGE

Gene/Protein Characteristic Table for KIAA0928

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04772
Accession No. :	AB023145
Description :	Endoribonuclease Dicer.
HUGO Gene Name :	dicer 1, ribonuclease type III (DICER1)
Clone Name :	hh16052 [Vector Info]
Source :	Human adult brain
Note :	We replaced hh03019, former representative clones for KIAA0928 with hh16052. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6037 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 30 bp

Genome contig ID gi51511730r_94526558
PolyA signal sequence
(AAGAAA,-7)
+----*----+----*----+----*----+----
GCTGAAACCGCTTTTTAAAATTCAAAACAAGAAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAACAAAAAAAATTAAGGGGAAAATTATTTAAATCGGAAAGGAAGACTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 r 94626558 94693512 27 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1922 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001154199	99.9	dicer1 isoform ...	Pan troglodytes
EAW81595	99.8	Dicer1, Dcr-1 h...	Homo sapiens
XP_001154010	99.8	dicer1 isoform ...	Pan troglodytes
Q9UPY3	100.0	Endoribonucleas...	Homo sapiens
XP_001100868	99.4	similar to dice...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR011545 45 207 PF00270 DNA/RNA helicase

IPR001650 499 556 PF00271 DNA/RNA helicase

IPR005034 630 722 PF03368 Protein of unknown function DUF283

IPR003100 891 1065 PF02170 Argonaute and Dicer protein

IPR000999 1313 1575 PF00636 Ribonuclease III

IPR000999 1702 1824 PF00636 Ribonuclease III

IPR001159 1853 1912 PF00035 Double-stranded RNA binding

HMMSmart IPR014001 40 249 SM00487 DEAD-like helicases

IPR001650 459 556 SM00490 DNA/RNA helicase

IPR000999 1295 1596 SM00535 Ribonuclease III

IPR000999 1681 1847 SM00535 Ribonuclease III

IPR001159 1850 1913 SM00358 Double-stranded RNA binding

ProfileScan IPR014021 51 227 PS51192 Helicase

IPR001650 433 602 PS51194 DNA/RNA helicase

IPR003100 891 1042 PS50821 Argonaute and Dicer protein

IPR000999 1283 1372 PS50142 Ribonuclease III

IPR000999 1666 1824 PS50142 Ribonuclease III

IPR001159 1849 1914 PS50137 Double-stranded RNA binding

ScanRegExp IPR000999 1702 1710 PS00517 Ribonuclease III

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011545	45	207	PF00270	DNA/RNA helicase
IPR001650	499	556	PF00271	DNA/RNA helicase
IPR005034	630	722	PF03368	Protein of unknown function DUF283
IPR003100	891	1065	PF02170	Argonaute and Dicer protein
IPR000999	1313	1575	PF00636	Ribonuclease III
IPR000999	1702	1824	PF00636	Ribonuclease III
IPR001159	1853	1912	PF00035	Double-stranded RNA binding
HMMSmart	IPR014001	40	249	SM00487	DEAD-like helicases
IPR001650	459	556	SM00490	DNA/RNA helicase
IPR000999	1295	1596	SM00535	Ribonuclease III
IPR000999	1681	1847	SM00535	Ribonuclease III
IPR001159	1850	1913	SM00358	Double-stranded RNA binding
ProfileScan	IPR014021	51	227	PS51192	Helicase
IPR001650	433	602	PS51194	DNA/RNA helicase
IPR003100	891	1042	PS50821	Argonaute and Dicer protein
IPR000999	1283	1372	PS50142	Ribonuclease III
IPR000999	1666	1824	PS50142	Ribonuclease III
IPR001159	1849	1914	PS50137	Double-stranded RNA binding
ScanRegExp	IPR000999	1702	1710	PS00517	Ribonuclease III

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCACCTTTACCCTTAGTCTCC

Primer_r
: AACTTTCACGGCATTAACAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GCACCTTTACCCTTAGTCTCC
Primer_r	: AACTTTCACGGCATTAACAGC
PCR product length	: 105 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	30 bp
Genome contig ID	gi51511730r_94526558
PolyA signal sequence (AAGAAA,-7)	+--------+--------+----*----+---- GCTGAAACCGCTTTTTAAAATTCAAAACAAGAAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAACAAAAAAAATTAAGGGGAAAATTATTTAAATCGGAAAGGAAGACTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	r	94626558	94693512	27	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0928

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information