HUGE

Gene/Protein Characteristic Table for KIAA0935

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05911
Accession No. :	AB023152
Description :	Epididymis-specific alpha-mannosidase precursor.
HUGO Gene Name :	mannosidase, alpha, class 2B, member 2 (MAN2B2)
Clone Name :	af13188 [Vector Info]
Source :	Human brain (amygdala)
Note :	We replaced hh04630, former representative clones for KIAA0935 with af13188. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 7720 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4859 bp

Genome contig ID gi89161207f_6527843
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
ACTAGAAACCAATGAATTAAAAACTTTGGAAGATG
Flanking genome sequence
(147188 - 147237)
----+----*----+----*----+----*----+----*----+----*
AATTTTATGGTCTGTGAATTATATCTCAATTTTAAAACTTTTTTTTTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 f 6627843 6675029 17 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 952 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW82392	99.7	mannosidase, al...	Homo sapiens
AAH33307	100.0	Mannosidase, al...	Homo sapiens
Q9Y2E5	99.9	Epididymis-spec...	Homo sapiens
AAH94773	99.9	Mannosidase, al...	Homo sapiens
EAW82389	99.7	mannosidase, al...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000602 26 350 PF01074 Glycoside hydrolase

IPR015341 354 437 PF09261 Glycoside hydrolase

IPR011682 473 935 PF07748 Glycosyl hydrolases 38

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000602	26	350	PF01074	Glycoside hydrolase
IPR015341	354	437	PF09261	Glycoside hydrolase
IPR011682	473	935	PF07748	Glycosyl hydrolases 38

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CACAAAACACAAACCCAGGAC

Primer_r
: GGATGAGTCTATGAAAACACG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4859 bp
Genome contig ID	gi89161207f_6527843
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- ACTAGAAACCAATGAATTAAAAACTTTGGAAGATG
Flanking genome sequence (147188 - 147237)	----+--------+--------+--------+--------+----* AATTTTATGGTCTGTGAATTATATCTCAATTTTAAAACTTTTTTTTTTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	f	6627843	6675029	17	99.3	Perfect prediction

Primer_f	: CACAAAACACAAACCCAGGAC
Primer_r	: GGATGAGTCTATGAAAACACG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0935

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information