HUGE |
Gene/Protein Characteristic Table for KIAA0935 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05911 |
---|---|
Accession No. : | AB023152 |
Description : | Epididymis-specific alpha-mannosidase precursor. |
HUGO Gene Name : | mannosidase, alpha, class 2B, member 2 (MAN2B2) |
Clone Name : | af13188 [Vector Info] |
Source : | Human brain (amygdala) |
Note : | We replaced hh04630, former representative clones for KIAA0935 with af13188. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7720 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 4859 bp Genome contig ID gi89161207f_6527843 PolyA signal sequence
(ATTAAA,-20) +----*----+----*----+----*----+----
ACTAGAAACCAATGAATTAAAAACTTTGGAAGATGFlanking genome sequence
(147188 - 147237) ----+----*----+----*----+----*----+----*----+----*
AATTTTATGGTCTGTGAATTATATCTCAATTTTAAAACTTTTTTTTTTTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 4 f 6627843 6675029 17 99.3 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 952 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CACAAAACACAAACCCAGGAC | |
: GGATGAGTCTATGAAAACACG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 4 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |