HUGE |
Gene/Protein Characteristic Table for KIAA0937 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00152 |
---|---|
Accession No. : | AB023154 |
Description : | Protein deltex-4. |
HUGO Gene Name : | deltex 4 homolog (Drosophila) (DTX4) |
Clone Name : | hh04715 [Vector Info] |
Flexi ORF Clone : | pF1KA0937
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5650 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3686 bp Genome contig ID gi51511727f_58596541 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
ACAAGAACACAAAAATAAAATGCAAATACAGAGCCFlanking genome sequence
(136097 - 136146) ----+----*----+----*----+----*----+----*----+----*
AGCTTTGTCACCCAAATCTGTGTCTATTTCTGATAGTCCATGGAATGTGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 11 f 58696541 58732636 9 99.3 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 653 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TCCCTGAGTCTGTAAGCAACC | |
: AATGTGGTCTGTTCCTTTAGG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 11 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |