HUGE

Gene/Protein Characteristic Table for KIAA0937

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00152
Accession No. :	AB023154
Description :	Protein deltex-4.
HUGO Gene Name :	deltex 4 homolog (Drosophila) (DTX4)
Clone Name :	hh04715 [Vector Info]
Flexi ORF Clone :	pF1KA0937
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5650 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3686 bp

Genome contig ID gi51511727f_58596541
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
ACAAGAACACAAAAATAAAATGCAAATACAGAGCC
Flanking genome sequence
(136097 - 136146)
----+----*----+----*----+----*----+----*----+----*
AGCTTTGTCACCCAAATCTGTGTCTATTTCTGATAGTCCATGGAATGTGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 f 58696541 58732636 9 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 653 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_508449	0	99.7	deltex 4 homolo...	Pan troglodytes
XP_001088765	0	97.1	similar to delt...	Macaca mulatta
Q9Y2E6	0	100.0	Protein deltex-...	Homo sapiens
Q6PDK8	1.2e-208	93.9	Protein deltex-...	Mus musculus
AAH58647	2.2e-208	93.7	Deltex 4 homolo...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040961	1.1e-40	46.2	KIAA1528

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004170 30 112 PF02825 WWE

IPR004170 113 189 PF02825 WWE

IPR001841 443 501 PF00097 Zinc finger

HMMSmart IPR004170 39 120 SM00678 WWE

IPR004170 122 197 SM00678 WWE

IPR001841 443 501 SM00184 Zinc finger

ProfileScan IPR004170 30 112 PS50918 WWE

IPR004170 113 189 PS50918 WWE

IPR001841 443 502 PS50089 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004170	30	112	PF02825	WWE
IPR004170	113	189	PF02825	WWE
IPR001841	443	501	PF00097	Zinc finger
HMMSmart	IPR004170	39	120	SM00678	WWE
IPR004170	122	197	SM00678	WWE
IPR001841	443	501	SM00184	Zinc finger
ProfileScan	IPR004170	30	112	PS50918	WWE
IPR004170	113	189	PS50918	WWE
IPR001841	443	502	PS50089	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCCCTGAGTCTGTAAGCAACC

Primer_r
: AATGTGGTCTGTTCCTTTAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3686 bp
Genome contig ID	gi51511727f_58596541
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- ACAAGAACACAAAAATAAAATGCAAATACAGAGCC
Flanking genome sequence (136097 - 136146)	----+--------+--------+--------+--------+----* AGCTTTGTCACCCAAATCTGTGTCTATTTCTGATAGTCCATGGAATGTGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	f	58696541	58732636	9	99.3	Perfect prediction

Primer_f	: TCCCTGAGTCTGTAAGCAACC
Primer_r	: AATGTGGTCTGTTCCTTTAGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0937

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information