HUGE |
Gene/Protein Characteristic Table for KIAA0943 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00154 |
---|---|
Accession No. : | AB023160 |
Description : | |
HUGO Gene Name : | ATG4 autophagy related 4 homolog B (S. cerevisiae) (ATG4B) |
Clone Name : | bm03784 [Vector Info] |
Flexi ORF Clone : | pF1KA0943
![]() |
Source : | Human adult brain |
Note : | We replaced hh08433, former representative clones for KIAA0943 with bm03784. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2778 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1586 bp Genome contig ID gi89161199f_242139095 PolyA signal sequence
(None) +----*----+----*----+----*----+----
TTCTTAATGGCAAATAATAAGTTTCAGTAGAAAACFlanking genome sequence
(122849 - 122898) ----+----*----+----*----+----*----+----*----+----*
AAACCTTGTGTCTATTTTTTCCTTAAGTTCTAATTGAATGTGAGTTCCAG
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 f 242225793 242261942 13 99.3 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 396 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GTATCCTTTCTCCCTTGGGTG | |
: TCAAAACACACGAGACAAAGC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 2 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |