HUGE

Gene/Protein Characteristic Table for KIAA0943

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00154
Accession No. :	AB023160
Description :
HUGO Gene Name :	ATG4 autophagy related 4 homolog B (S. cerevisiae) (ATG4B)
Clone Name :	bm03784 [Vector Info]
Flexi ORF Clone :	pF1KA0943
Source :	Human adult brain
Note :	We replaced hh08433, former representative clones for KIAA0943 with bm03784. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 2778 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1586 bp

Genome contig ID gi89161199f_242139095
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTCTTAATGGCAAATAATAAGTTTCAGTAGAAAAC
Flanking genome sequence
(122849 - 122898)
----+----*----+----*----+----*----+----*----+----*
AAACCTTGTGTCTATTTTTTCCTTAAGTTCTAATTGAATGTGAGTTCCAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 242225793 242261942 13 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 396 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG64112	6.3e-184	100.0	unnamed protein...	Homo sapiens
2D1I	3.1e-183	99.7	Structure of hu...	Homo sapiens
Q9Y4P1	1.1e-182	100.0	Cysteine protea...	Homo sapiens
2CY7	1.1e-182	100.0	The crystal str...	Homo sapiens
AAY14919	4.6e-182	99.7	unknown [Homo s...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR005078 39 340 PF03416 Peptidase C54

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005078	39	340	PF03416	Peptidase C54

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTATCCTTTCTCCCTTGGGTG

Primer_r
: TCAAAACACACGAGACAAAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1586 bp
Genome contig ID	gi89161199f_242139095
PolyA signal sequence (None)	+--------+--------+----*----+---- TTCTTAATGGCAAATAATAAGTTTCAGTAGAAAAC
Flanking genome sequence (122849 - 122898)	----+--------+--------+--------+--------+----* AAACCTTGTGTCTATTTTTTCCTTAAGTTCTAATTGAATGTGAGTTCCAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	242225793	242261942	13	99.3	Perfect prediction

Primer_f	: GTATCCTTTCTCCCTTGGGTG
Primer_r	: TCAAAACACACGAGACAAAGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0943

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information