HUGE

Gene/Protein Characteristic Table for KIAA0953

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00157
Accession No. :	AB023170
Description :
HUGO Gene Name :
Clone Name :	hj05484 [Vector Info]
Flexi ORF Clone :	pF1KA0953
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5161 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2791 bp

Genome contig ID gi89161199f_25018598
PolyA signal sequence
(ACTAAA,-33)
+----*----+----*----+----*----+----
TTACTAAAACTACAAAAAATTAGCCGGGCATGGTG
Flanking genome sequence
(205665 - 205714)
----+----*----+----*----+----*----+----*----+----*
GCGGCCACCTGTAACTCAGCTACTGGGGAGGCTGAGGCAGGAGAATCACT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 25118503 25224261 19 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 789 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y2G0	100.0	Protein EFR3 ho...	Homo sapiens
XP_001066858	97.8	similar to RIKE...	Rattus norvegicus
XP_233942	92.2	similar to RIKE...	Rattus norvegicus
Q6ZQ18	97.5	Protein EFR3 ho...	Mus musculus
XP_532893	97.9	similar to RIKE...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D63477	7.8e-118	60.0	KIAA0143

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGTGAATATCCAATGTTGCTC

Primer_r
: GCTATGCTCGGCTTTAACTCG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GGTGAATATCCAATGTTGCTC
Primer_r	: GCTATGCTCGGCTTTAACTCG
PCR product length	: 93 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2791 bp
Genome contig ID	gi89161199f_25018598
PolyA signal sequence (ACTAAA,-33)	+--------+--------+----*----+---- TTACTAAAACTACAAAAAATTAGCCGGGCATGGTG
Flanking genome sequence (205665 - 205714)	----+--------+--------+--------+--------+----* GCGGCCACCTGTAACTCAGCTACTGGGGAGGCTGAGGCAGGAGAATCACT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	25118503	25224261	19	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA0953

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information