HUGE |
Gene/Protein Characteristic Table for KIAA0958 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00697 |
---|---|
Accession No. : | AB023175 |
Description : | GDP-fucose protein O-fucosyltransferase 2 precursor. |
HUGO Gene Name : | protein O-fucosyltransferase 2 (POFUT2) |
Clone Name : | hj05707 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0958 |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4804 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3515 bp Genome contig ID gi51511750r_45408280 PolyA signal sequence
(AATAAA,-17) +----*----+----*----+----*----+----
ACCTTCCTTTTTAAGAAAAATAAACTGCTTTATGGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAGTTGGTAGCTGTGGAGTGTAGACTCATTAGACTCATTTCCTGCCACAC
Chr f/r start end exon identity class ContigView(URL based/DAS) 21 r 45508280 45532228 8 99.2 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 428 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CAGGGTCCTATGGTGTTACTC | |
: CAACTGATGAAAAAGGCACTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 21 |
: GeneBridge 4 | |
: CAGGGTCCTATGGTGTTACTC | |
: CAACTGATGAAAAAGGCACTG | |
: 98 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |