HUGE |
Gene/Protein Characteristic Table for KIAA0962 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00699 |
---|---|
Accession No. : | AB023179 |
Description : | DnaJ homolog subfamily C member 16 precursor. |
HUGO Gene Name : | DnaJ (Hsp40) homolog, subfamily C, member 16 (DNAJC16) |
Clone Name : | hj05850s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0962 |
Source : | Human adult brain |
Note : | We replaced hj05850, former representative clones for KIAA0962 with hj05850s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6035 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 3566 bp Genome contig ID gi89161185f_15625939 PolyA signal sequence
(GATAAA,-15) +----*----+----*----+----*----+----
AATAAACTATTTTAATGTCTGATAAAAAAAAAAACFlanking genome sequence None
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 15725939 15770815 15 100.0 Terminal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 822 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CAGCCAGTTAGAGAGCATACC | |
: CCTTGCTTTGACATTTGAACG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 1 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |