HUGE

Gene/Protein Characteristic Table for KIAA0981

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06366
Accession No. :	AB023198
Description :	FYVE finger-containing phosphoinositide kinase.
HUGO Gene Name :	phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III (PIP5K3)
Clone Name :	hj07094 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5182 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3444 bp

Genome contig ID gi89161199f_208809846
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TAAAGAAATCTTAACAATAAACTCAGAATCTACTT
Flanking genome sequence
(121870 - 121919)
----+----*----+----*----+----*----+----*----+----*
ACTCCACTTAGTTTTGAATCTGCTTGAAGAAATTGACAACAAAAGGAAAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 208909846 208931714 15 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 578 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW70449	100.0	phosphatidylino...	Homo sapiens
EAW70444	100.0	phosphatidylino...	Homo sapiens
AAI56452	100.0	Phosphatidylino...	synthetic construct
Q9Y2I7	100.0	FYVE finger-con...	Homo sapiens
BAC03674	99.8	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002498 327 564 PF01504 Phosphatidylinositol-4-phosphate 5-kinase

HMMSmart IPR002498 271 565 SM00330 Phosphatidylinositol-4-phosphate 5-kinase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002498	327	564	PF01504	Phosphatidylinositol-4-phosphate 5-kinase
HMMSmart	IPR002498	271	565	SM00330	Phosphatidylinositol-4-phosphate 5-kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGCTTTTGTGATGGCATTGTG

Primer_r
: ACTTGAGGAATAATGAATGGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3444 bp
Genome contig ID	gi89161199f_208809846
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TAAAGAAATCTTAACAATAAACTCAGAATCTACTT
Flanking genome sequence (121870 - 121919)	----+--------+--------+--------+--------+----* ACTCCACTTAGTTTTGAATCTGCTTGAAGAAATTGACAACAAAAGGAAAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	208909846	208931714	15	99.2	Perfect prediction

Primer_f	: AGCTTTTGTGATGGCATTGTG
Primer_r	: ACTTGAGGAATAATGAATGGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0981

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information