HUGE |
Gene/Protein Characteristic Table for KIAA0988 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00708 |
---|---|
Accession No. : | AB023205 |
Description : | Tubulin-specific chaperone D. |
HUGO Gene Name : | |
Clone Name : | hk04388 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0988 |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3927 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 239 bp Genome contig ID gi51511734f_78203250 PolyA signal sequence
(TATAAA,-19) +----*----+----*----+----*----+----
ACACAAATGTGCTTCCTATAAAATCATGTACCAAGFlanking genome sequence
(290619 - 290668) ----+----*----+----*----+----*----+----*----+----*
AAGTTCCTGCCTTTTGTCTCTGAGCCTGATGTGTGTAGGGGTGATGGAAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 f 78303250 78493867 39 99.8 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1210 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TGTGTGACCTTCTGGGCGTAC | |
: TCAAGTGAAGGCAGAGGCGTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 17 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |