HUGE

Gene/Protein Characteristic Table for KIAA0996

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00162
Accession No. :	AB023213
Description :	Zinc finger protein DZIP1.
HUGO Gene Name :	DAZ interacting protein 1 (DZIP1)
Clone Name :	hk07913 [Vector Info]
Flexi ORF Clone :	pF1KA0996
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4502 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1117 bp

Genome contig ID gi51511729r_94931372
PolyA signal sequence
(AGTAAA,-21)
+----*----+----*----+----*----+----
TTGTCAACCTTTTCAGTAAAGCCCTCTGTTACATC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTGTGACTGTGGCTGTGTTATTAGAGATGAATTCTGAGTTAAATTTGTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 13 r 95031372 95094945 22 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 869 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAH71600	100.0	DAZ interacting...	Homo sapiens
EAX08958	99.9	DAZ interacting...	Homo sapiens
XP_001137818	99.2	DAZ interacting...	Pan troglodytes
XP_001085701	96.3	similar to DAZ ...	Macaca mulatta
XP_001137916	95.7	DAZ interacting...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007087 219 242 PF00096 Zinc finger

HMMSmart IPR015880 219 242 SM00355 Zinc finger

ProfileScan IPR007087 219 247 PS50157 Zinc finger

ScanRegExp IPR007087 221 242 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	219	242	PF00096	Zinc finger
HMMSmart	IPR015880	219	242	SM00355	Zinc finger
ProfileScan	IPR007087	219	247	PS50157	Zinc finger
ScanRegExp	IPR007087	221	242	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTTTAAGACTTCCGCTGCTGC

Primer_r
: GCCTACGATACGACAGCATAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 13

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GTTTAAGACTTCCGCTGCTGC
Primer_r	: GCCTACGATACGACAGCATAC
PCR product length	: 202 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1117 bp
Genome contig ID	gi51511729r_94931372
PolyA signal sequence (AGTAAA,-21)	+--------+--------+----*----+---- TTGTCAACCTTTTCAGTAAAGCCCTCTGTTACATC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTGTGACTGTGGCTGTGTTATTAGAGATGAATTCTGAGTTAAATTTGTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	13	r	95031372	95094945	22	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0996

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information