HUGE

Gene/Protein Characteristic Table for KIAA0998

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07245
Accession No. :	AB023215
Description :	Tubulin--tyrosine ligase-like protein 5.
HUGO Gene Name :
Clone Name :	hk08691 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4313 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 632 bp

Genome contig ID gi51511730f_75117639
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
CTGATTTCAAAGATTAATAAAGTAATTCTATTTTT
Flanking genome sequence
(373537 - 373586)
----+----*----+----*----+----*----+----*----+----*
ATTTTCTTTTTTTTCCCTTTACTAATTTCCCAACAATCAATATTCACAAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 f 75205603 75491174 30 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1226 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAP75557	100.0	SRC1 and TIF2 a...	Homo sapiens
EAW81247	99.9	hCG2028821, iso...	Homo sapiens
Q6EMB2	99.8	Tubulin polyglu...	Homo sapiens
NP_055887	99.8	tubulin tyrosin...	Homo sapiens
EAW81244	99.9	hCG2028821, iso...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D79995	8.6e-32	38.0	KIAA0173

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004344 56 351 PF03133 Tubulin-tyrosine ligase

ProfileScan IPR004344 7 352 PS51221 Tubulin-tyrosine ligase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004344	56	351	PF03133	Tubulin-tyrosine ligase
ProfileScan	IPR004344	7	352	PS51221	Tubulin-tyrosine ligase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GAGCATTCATCACAAGTTTCC

Primer_r
: ATCAGTAATTCCAAAGGGTGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GAGCATTCATCACAAGTTTCC
Primer_r	: ATCAGTAATTCCAAAGGGTGC
PCR product length	: 94 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	632 bp
Genome contig ID	gi51511730f_75117639
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CTGATTTCAAAGATTAATAAAGTAATTCTATTTTT
Flanking genome sequence (373537 - 373586)	----+--------+--------+--------+--------+----* ATTTTCTTTTTTTTCCCTTTACTAATTTCCCAACAATCAATATTCACAAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	f	75205603	75491174	30	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA0998

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information