HUGE |
Gene/Protein Characteristic Table for KIAA1002 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00163 |
---|---|
Accession No. : | AB023219 |
Description : | R3H domain-containing protein 2. |
HUGO Gene Name : | R3H domain containing 2 (R3HDM2) |
Clone Name : | hk09859 [Vector Info] |
Flexi ORF Clone : | pF1KA1002
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4331 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1008 bp Genome contig ID gi89161190r_55833908 PolyA signal sequence
(TATAAA,-25) +----*----+----*----+----*----+----
TGTTTTTAAATATAAAAAAAAAAATCTGTCACTGGFlanking genome sequence
(99907 - 99858) ----+----*----+----*----+----*----+----*----+----*
ACATCAGTCACTGTTTCTCTGTTGCCGCCCTGGTATGGGTAAAGGGTTGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 12 r 55933815 56111055 24 99.6 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 962 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TTCCCCATCTTGTCTTCCTAG | |
: CAGTGAATATACCCAGCAAAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 12 |
: CCR | |
: TTCCCCATCTTGTCTTCCTAG | |
: CAGTGAATATACCCAGCAAAC | |
: 155 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |