HUGE

Gene/Protein Characteristic Table for KIAA1007

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04593
Accession No. :	AB023224
Description :	CCR4-NOT transcription complex, subunit 1 isoform a.
HUGO Gene Name :	CCR4-NOT transcription complex, subunit 1 (CNOT1)
Clone Name :	bg00162 [Vector Info]
Source :	Human adult brain
Note :	We replaced hk10102, former representative clones for KIAA1007 with bg00162. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6518 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1009 bp

Genome contig ID gi51511732r_57011355
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
ATACTGTAGCTAACCATTAAAGTCATGACACACAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATGAGTCCACTGTGCCTTTCTCAGTAGCAGCAGCCAGTGCTGGTGGTGAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 r 57111355 57167964 36 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1835 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
ABQ66268	99.9	CNOT1 [Homo sap...	Homo sapiens
A5YKK6	99.7	CCR4-NOT transc...	Homo sapiens
XP_001102008	99.6	similar to CCR4...	Macaca mulatta
CAH18093	99.6	hypothetical pr...	Homo sapiens
XP_613555	99.5	CCR4-NOT transc...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007196 1455 1835 PF04054 CCR4-Not complex component

ScanRegExp IPR001220 1713 1719 PS00307 Legume lectin

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007196	1455	1835	PF04054	CCR4-Not complex component
ScanRegExp	IPR001220	1713	1719	PS00307	Legume lectin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TATAAAGGGAAACCAGACCAG

Primer_r
: TTCAGTGGGGTAATGGGGGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TATAAAGGGAAACCAGACCAG
Primer_r	: TTCAGTGGGGTAATGGGGGAG
PCR product length	: 142 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1009 bp
Genome contig ID	gi51511732r_57011355
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- ATACTGTAGCTAACCATTAAAGTCATGACACACAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGAGTCCACTGTGCCTTTCTCAGTAGCAGCAGCCAGTGCTGGTGGTGAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	r	57111355	57167964	36	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA1007

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information