HUGE

Gene/Protein Characteristic Table for KIAA1029

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00717
Accession No. :	AB028952
Description :	Synaptopodin.
HUGO Gene Name :	synaptopodin (SYNPO)
Clone Name :	fh00363 [Vector Info]
Flexi ORF Clone :	pF1KSDA1029
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5332 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2124 bp

Genome contig ID gi51511721f_149900446
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TGCAGCTCTGGCCCTCAATAAATGCTTCCTGCATT
Flanking genome sequence
(118518 - 118567)
----+----*----+----*----+----*----+----*----+----*
CTTCTGCCTCCTGTGTCATTTTCAGCTGTGTCTGATGTCCTTCCCTTCTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 f 150000446 150018962 3 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1015 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_527075	0	98.9	synaptopodin [P...	Pan troglodytes
XP_001099989	0	96.9	similar to syna...	Macaca mulatta
AAQ07402	0	100.0	synaptopodin [H...	Homo sapiens
AAI52539	1.1e-216	100.0	SYNPO protein [...	Homo sapiens
Q8N3V7	3.1e-186	99.4	Synaptopodin.	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCCCTGTCATGCTACTTTCTC

Primer_r
: ATGGTAGCTCTGTATCTCTTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	2124 bp
Genome contig ID	gi51511721f_149900446
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TGCAGCTCTGGCCCTCAATAAATGCTTCCTGCATT
Flanking genome sequence (118518 - 118567)	----+--------+--------+--------+--------+----* CTTCTGCCTCCTGTGTCATTTTCAGCTGTGTCTGATGTCCTTCCCTTCTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	f	150000446	150018962	3	99.5	Perfect prediction

Primer_f	: TCCCTGTCATGCTACTTTCTC
Primer_r	: ATGGTAGCTCTGTATCTCTTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1029

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information