HUGE

Gene/Protein Characteristic Table for KIAA1031

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07405
Accession No. :	AB028954
Description :	Zinc finger CCCH domain-containing protein 7B.
HUGO Gene Name :	zinc finger CCCH-type containing 7B (ZC3H7B)
Clone Name :	fh00470 [Vector Info]
Flexi ORF Clone :	pF1KA1031
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5497 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2674 bp

Genome contig ID gi89161203f_39951700
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TTTTGTCCTTCTTAAAATAAAATGAAAGAAACTTG
Flanking genome sequence
(134355 - 134404)
----+----*----+----*----+----*----+----*----+----*
CTTCCCTTAGCCTTTGTTCTAGAAAATAAACTTGTGCACTTTGACCTCTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 22 f 40051696 40086053 20 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 940 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAI23515	100.0	zinc finger CCC...	Homo sapiens
BAG37501	99.9	unnamed protein...	Homo sapiens
AAI52559	99.6	Zinc finger CCC...	Homo sapiens
XP_001168979	99.0	zinc finger CCC...	Pan troglodytes
XP_001168953	98.0	zinc finger CCC...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001440 45 78 PF00515 Tetratricopeptide TPR_1

IPR001440 79 112 PF00515 Tetratricopeptide TPR_1

IPR000571 443 469 PF00642 Zinc finger

IPR000571 575 600 PF00642 Zinc finger

IPR000571 718 744 PF00642 Zinc finger

IPR000571 850 876 PF00642 Zinc finger

HMMSmart IPR013026 45 78 SM00028 Tetratricopeptide region

IPR013026 79 112 SM00028 Tetratricopeptide region

IPR000571 444 470 SM00356 Zinc finger

IPR000571 574 600 SM00356 Zinc finger

IPR000571 719 744 SM00356 Zinc finger

IPR000571 851 876 SM00356 Zinc finger

ProfileScan IPR013026 45 78 PS50005 Tetratricopeptide region

IPR013026 45 112 PS50293 Tetratricopeptide region

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001440	45	78	PF00515	Tetratricopeptide TPR_1
IPR001440	79	112	PF00515	Tetratricopeptide TPR_1
IPR000571	443	469	PF00642	Zinc finger
IPR000571	575	600	PF00642	Zinc finger
IPR000571	718	744	PF00642	Zinc finger
IPR000571	850	876	PF00642	Zinc finger
HMMSmart	IPR013026	45	78	SM00028	Tetratricopeptide region
IPR013026	79	112	SM00028	Tetratricopeptide region
IPR000571	444	470	SM00356	Zinc finger
IPR000571	574	600	SM00356	Zinc finger
IPR000571	719	744	SM00356	Zinc finger
IPR000571	851	876	SM00356	Zinc finger
ProfileScan	IPR013026	45	78	PS50005	Tetratricopeptide region
IPR013026	45	112	PS50293	Tetratricopeptide region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCTGAGGGCAATGATCTGTTC

Primer_r
: AGGCCCATGGTGAAGTAGCAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 22

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GCTGAGGGCAATGATCTGTTC
Primer_r	: AGGCCCATGGTGAAGTAGCAG
PCR product length	: 170 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2674 bp
Genome contig ID	gi89161203f_39951700
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTTTGTCCTTCTTAAAATAAAATGAAAGAAACTTG
Flanking genome sequence (134355 - 134404)	----+--------+--------+--------+--------+----* CTTCCCTTAGCCTTTGTTCTAGAAAATAAACTTGTGCACTTTGACCTCTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	22	f	40051696	40086053	20	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA1031

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information