HUGE |
Gene/Protein Characteristic Table for KIAA1032 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK00168 |
---|---|
Accession No. : | AB028955 |
Description : | Unc-13 homolog A. |
HUGO Gene Name : | unc-13 homolog A (C. elegans) (UNC13A) |
Clone Name : | ff09715 [Vector Info] |
Flexi ORF Clone : | pF1KA1032
![]() |
Source : | Human fetal brain |
Note : | We replaced fh00485, former representative clones for KIAA1032 with ff09715. (1999/8/04) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 9825 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 4715 bp Genome contig ID gi42406306r_17473167 PolyA signal sequence
(ATTAAA,-24) +----*----+----*----+----*----+----
TAACAGCAGACATTAAAAAAAGAAAAACCACACACFlanking genome sequence
(99979 - 99930) ----+----*----+----*----+----*----+----*----+----*
AGCCTTGGACACGTGGTTGCCTCCTCCTTGCATTCCTTTATCAGCAAAAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 19 r 17573146 17660006 42 99.4 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1702 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
RH mapping information |
Description | |
---|---|---|
: 19 |
: GeneBridge 4 | |
: CCAATGAGCAAAGTTACAGTG | |
: AAGCAGATCCCAGAGCAAGTG | |
: 100 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |