HUGE

Gene/Protein Characteristic Table for KIAA1032

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK00168
Accession No. :	AB028955
Description :	Unc-13 homolog A.
HUGO Gene Name :	unc-13 homolog A (C. elegans) (UNC13A)
Clone Name :	ff09715 [Vector Info]
Flexi ORF Clone :	pF1KA1032
Source :	Human fetal brain
Note :	We replaced fh00485, former representative clones for KIAA1032 with ff09715. (1999/8/04)

Features of the cloned DNA sequence	Description

Length: 9825 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4715 bp

Genome contig ID gi42406306r_17473167
PolyA signal sequence
(ATTAAA,-24)
+----*----+----*----+----*----+----
TAACAGCAGACATTAAAAAAAGAAAAACCACACAC
Flanking genome sequence
(99979 - 99930)
----+----*----+----*----+----*----+----*----+----*
AGCCTTGGACACGTGGTTGCCTCCTCCTTGCATTCCTTTATCAGCAAAAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 r 17573146 17660006 42 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 1702 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UPW8	100.0	Protein unc-13 ...	Homo sapiens
NP_001073890	99.9	unc-13 homolog ...	Homo sapiens
XP_605253	97.2	similar to Prot...	Bos taurus
Q4KUS2	95.7	Protein unc-13 ...	Mus musculus
BAE27895	95.5	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002219 550 564 PR00008 Protein kinase C

IPR002219 566 575 PR00008 Protein kinase C

IPR002219 579 590 PR00008 Protein kinase C

IPR002219 591 603 PR00008 Protein kinase C

IPR000008 692 704 PR00360 C2 calcium-dependent membrane targeting

IPR000008 716 729 PR00360 C2 calcium-dependent membrane targeting

IPR000008 737 745 PR00360 C2 calcium-dependent membrane targeting

HMMPfam IPR000008 3 78 PF00168 C2 calcium-dependent membrane targeting

IPR002219 553 605 PF00130 Protein kinase C

IPR000008 677 768 PF00168 C2 calcium-dependent membrane targeting

IPR010439 992 1101 PF06292 Protein of unknown function DUF1041

IPR010439 1222 1314 PF06292 Protein of unknown function DUF1041

IPR000008 1546 1636 PF00168 C2 calcium-dependent membrane targeting

HMMSmart IPR000008 2 93 SM00239 C2 calcium-dependent membrane targeting

IPR002219 553 602 SM00109 Protein kinase C

IPR000008 676 783 SM00239 C2 calcium-dependent membrane targeting

IPR000008 1545 1651 SM00239 C2 calcium-dependent membrane targeting

ProfileScan IPR002219 552 602 PS50081 Protein kinase C

IPR000008 676 768 PS50004 C2 calcium-dependent membrane targeting

IPR014770 1092 1235 PS51258 Munc13 homology 1

IPR014772 1344 1511 PS51259 Munc13 homology 2

IPR000008 1545 1636 PS50004 C2 calcium-dependent membrane targeting

ScanRegExp IPR002219 553 602 PS00479 Protein kinase C

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002219	550	564	PR00008	Protein kinase C
IPR002219	566	575	PR00008	Protein kinase C
IPR002219	579	590	PR00008	Protein kinase C
IPR002219	591	603	PR00008	Protein kinase C
IPR000008	692	704	PR00360	C2 calcium-dependent membrane targeting
IPR000008	716	729	PR00360	C2 calcium-dependent membrane targeting
IPR000008	737	745	PR00360	C2 calcium-dependent membrane targeting
HMMPfam	IPR000008	3	78	PF00168	C2 calcium-dependent membrane targeting
IPR002219	553	605	PF00130	Protein kinase C
IPR000008	677	768	PF00168	C2 calcium-dependent membrane targeting
IPR010439	992	1101	PF06292	Protein of unknown function DUF1041
IPR010439	1222	1314	PF06292	Protein of unknown function DUF1041
IPR000008	1546	1636	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR000008	2	93	SM00239	C2 calcium-dependent membrane targeting
IPR002219	553	602	SM00109	Protein kinase C
IPR000008	676	783	SM00239	C2 calcium-dependent membrane targeting
IPR000008	1545	1651	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR002219	552	602	PS50081	Protein kinase C
IPR000008	676	768	PS50004	C2 calcium-dependent membrane targeting
IPR014770	1092	1235	PS51258	Munc13 homology 1
IPR014772	1344	1511	PS51259	Munc13 homology 2
IPR000008	1545	1636	PS50004	C2 calcium-dependent membrane targeting
ScanRegExp	IPR002219	553	602	PS00479	Protein kinase C

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCAATGAGCAAAGTTACAGTG
Primer_r	: AAGCAGATCCCAGAGCAAGTG
PCR product length	: 100 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4715 bp
Genome contig ID	gi42406306r_17473167
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- TAACAGCAGACATTAAAAAAAGAAAAACCACACAC
Flanking genome sequence (99979 - 99930)	----+--------+--------+--------+--------+----* AGCCTTGGACACGTGGTTGCCTCCTCCTTGCATTCCTTTATCAGCAAAAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	r	17573146	17660006	42	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA1032

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information