HUGE

Gene/Protein Characteristic Table for KIAA1035

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04066
Accession No. :	AB028958
Description :	ATP/GTP binding protein 1.
HUGO Gene Name :	ATP/GTP binding protein 1 (AGTPBP1)
Clone Name :	hk08527 [Vector Info]
Flexi ORF Clone :	pF1KA1035
Source :	Human adult brain
Note :	We replaced fh00984, former representative clones for KIAA1035 with hk08527. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4394 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 567 bp

Genome contig ID gi89161216r_87251277
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
ACCAAATTAAACAAATAAAAACTGTATTAAATGTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
GCATTCATTTTGTCATCTTCTTTAACCAGCTCAGATTATTTGATGTATAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 r 87351277 87546621 26 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1220 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UPW5	99.9	Cytosolic carbo...	Homo sapiens
XP_001136238	99.8	ATP/GTP binding...	Pan troglodytes
XP_001107818	99.3	similar to ATP/...	Macaca mulatta
Q641K1	90.4	Cytosolic carbo...	Mus musculus
EDL93892	89.7	ATP/GTP binding...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000834 849 1127 PF00246 Peptidase M14

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000834	849	1127	PF00246	Peptidase M14

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTCTTCCAGCATCACACCTTC

Primer_r
: GGTAAGGACATGAGGCAGTTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	567 bp
Genome contig ID	gi89161216r_87251277
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- ACCAAATTAAACAAATAAAAACTGTATTAAATGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GCATTCATTTTGTCATCTTCTTTAACCAGCTCAGATTATTTGATGTATAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	r	87351277	87546621	26	100.0	Perfect prediction

Primer_f	: CTCTTCCAGCATCACACCTTC
Primer_r	: GGTAAGGACATGAGGCAGTTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1035

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information