| HUGE | 
| Gene/Protein Characteristic Table for KIAA1040 | 
| Link to : 
Rouge | 
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Mapping | |
| Product ID : | ORK00169 | 
|---|---|
| Accession No. : | AB028963 | 
| Description : | MON2 homolog. | 
| HUGO Gene Name : | MON2 homolog (S. cerevisiae) (MON2) | 
| Clone Name : | hh15271 [Vector Info] | 
| Flexi ORF Clone : | pF1KA1040  | 
| Source : | Human adult brain | 
| Note : | We replaced fh02456 and fh02456s1, former representative clones for KIAA1040 with hh15271. (2002/5/10,2002/5/10) | 
| Features of the cloned DNA sequence | Description | |
|---|---|---|
Length: 6387 bp
|   | 
| cloned DNA seq. | |
| Warning for N-terminal truncation: | NO | 
| Warning for coding interruption: | YES | 
Length of 3'UTR 871 bp Genome contig ID gi89161190f_61046896 PolyA signal sequence 
(None)
CATACCTCATTTCTTTAAACAGCTCTCCAAGCTTTFlanking genome sequence 
(226773 - 226822)
CACTGAAGTCTGTCTGTTTTTTATATTGGCTGTCTGGATTTTAAAGACTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 12 f 61146896 61273667 35 99.9 Perfect prediction 
| Features of the protein sequence | Description | |
|---|---|---|
Length: 1736 aa
|  | 
 | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
 
    | RH mapping information | Description | |
|---|---|---|
| : 12 | 
| : GeneBridge 4 | |
| : GTTAATTATCCCTCCCATCAG | |
| : TTCTTGGCAGCTGTTGTTGGC | |
| : 146 bp | |
| : 95 °C | 
| How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage   | |