HUGE |
Gene/Protein Characteristic Table for KIAA1040 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK00169 |
---|---|
Accession No. : | AB028963 |
Description : | MON2 homolog. |
HUGO Gene Name : | MON2 homolog (S. cerevisiae) (MON2) |
Clone Name : | hh15271 [Vector Info] |
Flexi ORF Clone : | pF1KA1040 |
Source : | Human adult brain |
Note : | We replaced fh02456 and fh02456s1, former representative clones for KIAA1040 with hh15271. (2002/5/10,2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6387 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 871 bp Genome contig ID gi89161190f_61046896 PolyA signal sequence
(None) +----*----+----*----+----*----+----
CATACCTCATTTCTTTAAACAGCTCTCCAAGCTTTFlanking genome sequence
(226773 - 226822) ----+----*----+----*----+----*----+----*----+----*
CACTGAAGTCTGTCTGTTTTTTATATTGGCTGTCTGGATTTTAAAGACTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 12 f 61146896 61273667 35 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1736 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
RH mapping information |
Description | |
---|---|---|
: 12 |
: GeneBridge 4 | |
: GTTAATTATCCCTCCCATCAG | |
: TTCTTGGCAGCTGTTGTTGGC | |
: 146 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |