HUGE

Gene/Protein Characteristic Table for KIAA1043

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK07241
Accession No. :	AB028966
Description :	Tetratricopeptide repeat protein 28.
HUGO Gene Name :	tetratricopeptide repeat domain 28 (TTC28)
Clone Name :	af02720 [Vector Info]
Source :	Human brain (amygdala)
Note :	We replaced fh02888 and fh17988, former representative clones for KIAA1043 with af02720. (2002/5/10,2002/5/10)

Features of the cloned DNA sequence	Description

Length: 7334 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 953 bp

Genome contig ID gi89161203r_26607256
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGGAAAGGTTGAAATGACTCCGTTTCCTTATAAGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATTTCCATGGCTAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 22 r 26707256 26889455 18 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 2126 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96AY4	100.0	Tetratricopepti...	Homo sapiens
XP_001172489	99.7	tetratricopepti...	Pan troglodytes
XP_001108189	99.0	hypothetical pr...	Macaca mulatta
XP_001495569	96.1	similar to Tetr...	Equus caballus
XP_617836	93.8	similar to Tetr...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001440 1 32 PF00515 Tetratricopeptide TPR_1

IPR001440 39 72 PF00515 Tetratricopeptide TPR_1

IPR001440 119 152 PF00515 Tetratricopeptide TPR_1

IPR001440 159 192 PF00515 Tetratricopeptide TPR_1

IPR001440 199 232 PF00515 Tetratricopeptide TPR_1

IPR001440 239 272 PF00515 Tetratricopeptide TPR_1

IPR013105 279 312 PF07719 Tetratricopeptide TPR_2

IPR001440 319 352 PF00515 Tetratricopeptide TPR_1

IPR001440 359 392 PF00515 Tetratricopeptide TPR_1

IPR001440 399 432 PF00515 Tetratricopeptide TPR_1

IPR001440 439 472 PF00515 Tetratricopeptide TPR_1

IPR001440 479 512 PF00515 Tetratricopeptide TPR_1

IPR001440 522 555 PF00515 Tetratricopeptide TPR_1

IPR001440 562 595 PF00515 Tetratricopeptide TPR_1

IPR001440 602 635 PF00515 Tetratricopeptide TPR_1

IPR001440 642 675 PF00515 Tetratricopeptide TPR_1

IPR001440 682 715 PF00515 Tetratricopeptide TPR_1

IPR001440 722 755 PF00515 Tetratricopeptide TPR_1

HMMSmart IPR013026 2 32 SM00028 Tetratricopeptide region

IPR013026 39 72 SM00028 Tetratricopeptide region

IPR013026 79 112 SM00028 Tetratricopeptide region

IPR013026 119 152 SM00028 Tetratricopeptide region

IPR013026 159 192 SM00028 Tetratricopeptide region

IPR013026 199 232 SM00028 Tetratricopeptide region

IPR013026 239 272 SM00028 Tetratricopeptide region

IPR013026 279 312 SM00028 Tetratricopeptide region

IPR013026 319 352 SM00028 Tetratricopeptide region

IPR013026 359 392 SM00028 Tetratricopeptide region

IPR013026 399 432 SM00028 Tetratricopeptide region

IPR013026 439 472 SM00028 Tetratricopeptide region

IPR013026 479 512 SM00028 Tetratricopeptide region

IPR013026 522 555 SM00028 Tetratricopeptide region

IPR013026 562 595 SM00028 Tetratricopeptide region

IPR013026 602 635 SM00028 Tetratricopeptide region

IPR013026 642 675 SM00028 Tetratricopeptide region

IPR013026 682 715 SM00028 Tetratricopeptide region

IPR013026 722 755 SM00028 Tetratricopeptide region

IPR013026 762 795 SM00028 Tetratricopeptide region

ProfileScan IPR013026 1 795 PS50293 Tetratricopeptide region

IPR013026 3 32 PS50005 Tetratricopeptide region

IPR013026 39 72 PS50005 Tetratricopeptide region

IPR013026 79 112 PS50005 Tetratricopeptide region

IPR013026 119 152 PS50005 Tetratricopeptide region

IPR013026 159 192 PS50005 Tetratricopeptide region

IPR013026 199 232 PS50005 Tetratricopeptide region

IPR013026 239 272 PS50005 Tetratricopeptide region

IPR013026 279 312 PS50005 Tetratricopeptide region

IPR013026 319 352 PS50005 Tetratricopeptide region

IPR013026 359 392 PS50005 Tetratricopeptide region

IPR013026 399 432 PS50005 Tetratricopeptide region

IPR013026 439 472 PS50005 Tetratricopeptide region

IPR013026 479 512 PS50005 Tetratricopeptide region

IPR013026 522 555 PS50005 Tetratricopeptide region

IPR013026 562 595 PS50005 Tetratricopeptide region

IPR013026 602 635 PS50005 Tetratricopeptide region

IPR013026 642 675 PS50005 Tetratricopeptide region

IPR013026 682 715 PS50005 Tetratricopeptide region

IPR013026 722 755 PS50005 Tetratricopeptide region

IPR013026 762 795 PS50005 Tetratricopeptide region

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001440	1	32	PF00515	Tetratricopeptide TPR_1
IPR001440	39	72	PF00515	Tetratricopeptide TPR_1
IPR001440	119	152	PF00515	Tetratricopeptide TPR_1
IPR001440	159	192	PF00515	Tetratricopeptide TPR_1
IPR001440	199	232	PF00515	Tetratricopeptide TPR_1
IPR001440	239	272	PF00515	Tetratricopeptide TPR_1
IPR013105	279	312	PF07719	Tetratricopeptide TPR_2
IPR001440	319	352	PF00515	Tetratricopeptide TPR_1
IPR001440	359	392	PF00515	Tetratricopeptide TPR_1
IPR001440	399	432	PF00515	Tetratricopeptide TPR_1
IPR001440	439	472	PF00515	Tetratricopeptide TPR_1
IPR001440	479	512	PF00515	Tetratricopeptide TPR_1
IPR001440	522	555	PF00515	Tetratricopeptide TPR_1
IPR001440	562	595	PF00515	Tetratricopeptide TPR_1
IPR001440	602	635	PF00515	Tetratricopeptide TPR_1
IPR001440	642	675	PF00515	Tetratricopeptide TPR_1
IPR001440	682	715	PF00515	Tetratricopeptide TPR_1
IPR001440	722	755	PF00515	Tetratricopeptide TPR_1
HMMSmart	IPR013026	2	32	SM00028	Tetratricopeptide region
IPR013026	39	72	SM00028	Tetratricopeptide region
IPR013026	79	112	SM00028	Tetratricopeptide region
IPR013026	119	152	SM00028	Tetratricopeptide region
IPR013026	159	192	SM00028	Tetratricopeptide region
IPR013026	199	232	SM00028	Tetratricopeptide region
IPR013026	239	272	SM00028	Tetratricopeptide region
IPR013026	279	312	SM00028	Tetratricopeptide region
IPR013026	319	352	SM00028	Tetratricopeptide region
IPR013026	359	392	SM00028	Tetratricopeptide region
IPR013026	399	432	SM00028	Tetratricopeptide region
IPR013026	439	472	SM00028	Tetratricopeptide region
IPR013026	479	512	SM00028	Tetratricopeptide region
IPR013026	522	555	SM00028	Tetratricopeptide region
IPR013026	562	595	SM00028	Tetratricopeptide region
IPR013026	602	635	SM00028	Tetratricopeptide region
IPR013026	642	675	SM00028	Tetratricopeptide region
IPR013026	682	715	SM00028	Tetratricopeptide region
IPR013026	722	755	SM00028	Tetratricopeptide region
IPR013026	762	795	SM00028	Tetratricopeptide region
ProfileScan	IPR013026	1	795	PS50293	Tetratricopeptide region
IPR013026	3	32	PS50005	Tetratricopeptide region
IPR013026	39	72	PS50005	Tetratricopeptide region
IPR013026	79	112	PS50005	Tetratricopeptide region
IPR013026	119	152	PS50005	Tetratricopeptide region
IPR013026	159	192	PS50005	Tetratricopeptide region
IPR013026	199	232	PS50005	Tetratricopeptide region
IPR013026	239	272	PS50005	Tetratricopeptide region
IPR013026	279	312	PS50005	Tetratricopeptide region
IPR013026	319	352	PS50005	Tetratricopeptide region
IPR013026	359	392	PS50005	Tetratricopeptide region
IPR013026	399	432	PS50005	Tetratricopeptide region
IPR013026	439	472	PS50005	Tetratricopeptide region
IPR013026	479	512	PS50005	Tetratricopeptide region
IPR013026	522	555	PS50005	Tetratricopeptide region
IPR013026	562	595	PS50005	Tetratricopeptide region
IPR013026	602	635	PS50005	Tetratricopeptide region
IPR013026	642	675	PS50005	Tetratricopeptide region
IPR013026	682	715	PS50005	Tetratricopeptide region
IPR013026	722	755	PS50005	Tetratricopeptide region
IPR013026	762	795	PS50005	Tetratricopeptide region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 22

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GCTCCCGACATAGACAAACTG
Primer_r	: TTCTTATTGTGCCGTGGTGAC
PCR product length	: 197 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	953 bp
Genome contig ID	gi89161203r_26607256
PolyA signal sequence (None)	+--------+--------+----*----+---- AGGAAAGGTTGAAATGACTCCGTTTCCTTATAAGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATTTCCATGGCTAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	22	r	26707256	26889455	18	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA1043

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information