HUGE |
Gene/Protein Characteristic Table for KIAA1048 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00722 |
---|---|
Accession No. : | AB028971 |
Description : | AP2-associated protein kinase 1. |
HUGO Gene Name : | AP2 associated kinase 1 (AAK1) |
Clone Name : | hh02560 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1048 |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4506 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1530 bp Genome contig ID gi89161199r_69461797 PolyA signal sequence
(None) +----*----+----*----+----*----+----
TCAGGAGCAAGACACCATCTCAAAAAATGAGAATTFlanking genome sequence
(99895 - 99846) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAGAAGAAAGCTTCACAGAATTTCCTAAAGAAACTTCTGACTC
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 r 69561692 69724353 18 99.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 897 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: AGATGGATTAATGGCCTTTGC | |
: ACATAAGCCGCTCAGCAAACC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 2 |
: GeneBridge 4 | |
: AGATGGATTAATGGCCTTTGC | |
: ACATAAGCCGCTCAGCAAACC | |
: 144 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |