| HUGE | 
Gene/Protein Characteristic Table for KIAA1048 | 
| 
Link to : 
Rouge | 
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00722 | 
|---|---|
| Accession No. : | AB028971 | 
| Description : | AP2-associated protein kinase 1. | 
| HUGO Gene Name : | AP2 associated kinase 1 (AAK1) | 
| Clone Name : | hh02560 [Vector Info] | 
| Flexi ORF Clone : | pF1KSDA1048
                   ![]()  | 
| Source : | Human adult brain | 
Features of the cloned DNA sequence | 
Description | |
|---|---|---|
Length: 4506 bp
 
       | 
| cloned DNA seq. | |
Warning for N-terminal truncation:  | NO | 
Warning for coding interruption:  | NO | 
Length of 3'UTR 1530 bp Genome contig ID gi89161199r_69461797 PolyA signal sequence 
(None) +----*----+----*----+----*----+----
TCAGGAGCAAGACACCATCTCAAAAAATGAGAATTFlanking genome sequence 
(99895 - 99846) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAGAAGAAAGCTTCACAGAATTTCCTAAAGAAACTTCTGACTC
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 r 69561692 69724353 18 99.0 Perfect prediction 
Features of the protein sequence | 
Description | |
|---|---|---|
Length: 897 aa
![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
    Expression profile | 
Description | |
|---|---|---|
| RT-PCR-ELISA | Description | 
|---|

Experimental conditions
| : AGATGGATTAATGGCCTTTGC | |
| : ACATAAGCCGCTCAGCAAACC | |
| : 95 °C | 
RH mapping information | 
Description | |
|---|---|---|
| : 2 | 
| : GeneBridge 4 | |
| : AGATGGATTAATGGCCTTTGC | |
| : ACATAAGCCGCTCAGCAAACC | |
| : 144 bp | |
| : 95 °C | 
| 
 
 How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage  
 
  | |