HUGE

Gene/Protein Characteristic Table for KIAA1051

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00723
Accession No. :	AB028974
Description :
HUGO Gene Name :	paternally expressed 10 (PEG10)
Clone Name :	hh04271 [Vector Info]
Flexi ORF Clone :	pF1KSDA1051
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6188 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 4010 bp

Genome contig ID gi89161213f_94030753
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
AATAAAAATTCAATAAAGATTTAGTGGTTAAGTGC
Flanking genome sequence
(106189 - 106238)
----+----*----+----*----+----*----+----*----+----*
AAACTGTGTCCTGATCATTTCAGCATCTACCAGCATCAAGGGAATGGGGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 f 94130753 94136940 1 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 402 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q86TG7	7.5e-133	100.0	Retrotransposon...	Homo sapiens
XP_001915670	8.4e-127	95.6	paternally expr...	Equus caballus
NP_001120682	1.8e-123	92.7	paternally expr...	Bos taurus
NP_001120696	2.1e-114	93.8	paternally expr...	Sus scrofa
Q7TN75	2.3e-42	50.3	Retrotransposon...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATGTGAAGCTGCCAATGGATG

Primer_r
: CAGTTCAAGGTAGTAGCAAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GAACTTGTCAATGATGGATGG
Primer_r	: GGCAATGGGGTTCAGTGGTAG
PCR product length	: 113 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	4010 bp
Genome contig ID	gi89161213f_94030753
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- AATAAAAATTCAATAAAGATTTAGTGGTTAAGTGC
Flanking genome sequence (106189 - 106238)	----+--------+--------+--------+--------+----* AAACTGTGTCCTGATCATTTCAGCATCTACCAGCATCAAGGGAATGGGGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	f	94130753	94136940	1	99.0	Perfect prediction

Primer_f	: ATGTGAAGCTGCCAATGGATG
Primer_r	: CAGTTCAAGGTAGTAGCAAGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1051

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information