HUGE

Gene/Protein Characteristic Table for KIAA1067

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00729
Accession No. :	AB028990
Description :	Exocyst complex component 7.
HUGO Gene Name :	exocyst complex component 7 (EXOC7)
Clone Name :	hj05418 [Vector Info]
Flexi ORF Clone :	pF1KSDA1067
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4704 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2631 bp

Genome contig ID gi51511734r_71488693
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
TTCATTGTAAAAATAAATGTACTTTGCACCACTTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATGATGGAGGGAGAAGTGGTCACAGGCTCGTCAGTCTATCATCTCACAGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 r 71588693 71611386 19 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 690 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH11045	100.0	Exocyst complex...	Homo sapiens
CAH92744	99.6	hypothetical pr...	Pongo abelii
XP_001491890	96.9	similar to exoc...	Equus caballus
CAM16800	96.6	exocyst complex...	Mus musculus
XP_001369127	94.4	similar to exoc...	Monodelphis dom...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004140 61 687 PF03081 Exo70 exocyst complex subunit

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004140	61	687	PF03081	Exo70 exocyst complex subunit

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATGAACCAGGAAGGAGAGATC

Primer_r
: AACTGGAGACAATTTGGGATG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: CCR
Primer_f	: ATGAACCAGGAAGGAGAGATC
Primer_r	: AACTGGAGACAATTTGGGATG
PCR product length	: 170 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2631 bp
Genome contig ID	gi51511734r_71488693
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TTCATTGTAAAAATAAATGTACTTTGCACCACTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGATGGAGGGAGAAGTGGTCACAGGCTCGTCAGTCTATCATCTCACAGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	r	71588693	71611386	19	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA1067

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information