HUGE |
Gene/Protein Characteristic Table for KIAA1067 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00729 |
---|---|
Accession No. : | AB028990 |
Description : | Exocyst complex component 7. |
HUGO Gene Name : | exocyst complex component 7 (EXOC7) |
Clone Name : | hj05418 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1067
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4704 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2631 bp Genome contig ID gi51511734r_71488693 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
TTCATTGTAAAAATAAATGTACTTTGCACCACTTCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATGATGGAGGGAGAAGTGGTCACAGGCTCGTCAGTCTATCATCTCACAGC
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 r 71588693 71611386 19 99.4 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 690 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: ATGAACCAGGAAGGAGAGATC | |
: AACTGGAGACAATTTGGGATG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 17 |
: CCR | |
: ATGAACCAGGAAGGAGAGATC | |
: AACTGGAGACAATTTGGGATG | |
: 170 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |