HUGE

Gene/Protein Characteristic Table for KIAA1102

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05830
Accession No. :	AB029025
Description :	LIM and calponin homology domains 1.
HUGO Gene Name :
Clone Name :	bh00035 [Vector Info]
Source :	Human adult brain
Note :	We replaced hk10140, former representative clones for KIAA1102 with bh00035. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5113 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1807 bp

Genome contig ID gi89161207f_40957561
PolyA signal sequence
(AATAAA,-11)
+----*----+----*----+----*----+----
TGCTGTTTTACAGGAAAAAATAAAAATAAAAAAAG
Flanking genome sequence
(438208 - 438257)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAGAAAAAATTAAAAAGAAAAATTGTTTTGAAAATGTACAGATCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 f 41057561 41395767 25 99.6 Internal No-hit

Features of the protein sequence	Description

Length: 1101 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UPQ0	100.0	LIM and calponi...	Homo sapiens
EAW92984	99.9	hypothetical pr...	Homo sapiens
EAW92988	99.8	hypothetical pr...	Homo sapiens
NP_001106188	97.5	LIM and calponi...	Homo sapiens
CAI45946	97.4	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020665	5.7e-22	28.9	KIAA0858

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR003247 69 108 PD001527 Calponin-like actin-binding subtype

IPR001781 1031 1089 PD000094 Zinc finger

FPrintScan IPR001997 43 57 PR00889 Calponin

IPR003096 62 77 PR00888 SM22/calponin

IPR001997 73 90 PR00889 Calponin

IPR003096 95 111 PR00888 SM22/calponin

IPR003096 111 126 PR00888 SM22/calponin

HMMPfam IPR001715 40 156 PF00307 Calponin-like actin-binding

IPR001781 1031 1094 PF00412 Zinc finger

HMMSmart IPR001715 41 142 SM00033 Calponin-like actin-binding

IPR001781 1030 1088 SM00132 Zinc finger

ProfileScan IPR001715 39 143 PS50021 Calponin-like actin-binding

IPR001781 1029 1095 PS50023 Zinc finger

ScanRegExp IPR001781 1031 1067 PS00478 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR003247	69	108	PD001527	Calponin-like actin-binding subtype
IPR001781	1031	1089	PD000094	Zinc finger
FPrintScan	IPR001997	43	57	PR00889	Calponin
IPR003096	62	77	PR00888	SM22/calponin
IPR001997	73	90	PR00889	Calponin
IPR003096	95	111	PR00888	SM22/calponin
IPR003096	111	126	PR00888	SM22/calponin
HMMPfam	IPR001715	40	156	PF00307	Calponin-like actin-binding
IPR001781	1031	1094	PF00412	Zinc finger
HMMSmart	IPR001715	41	142	SM00033	Calponin-like actin-binding
IPR001781	1030	1088	SM00132	Zinc finger
ProfileScan	IPR001715	39	143	PS50021	Calponin-like actin-binding
IPR001781	1029	1095	PS50023	Zinc finger
ScanRegExp	IPR001781	1031	1067	PS00478	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AAGGGGGACTATTTATTCTGC

Primer_r
: AGCCATACTCAATAAGACACG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AAGGGGGACTATTTATTCTGC
Primer_r	: AGCCATACTCAATAAGACACG
PCR product length	: 173 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1807 bp
Genome contig ID	gi89161207f_40957561
PolyA signal sequence (AATAAA,-11)	+--------+--------+----*----+---- TGCTGTTTTACAGGAAAAAATAAAAATAAAAAAAG
Flanking genome sequence (438208 - 438257)	----+--------+--------+--------+--------+----* AAAAAAAGAAAAAATTAAAAAGAAAAATTGTTTTGAAAATGTACAGATCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	f	41057561	41395767	25	99.6	Internal No-hit

Gene/Protein Characteristic Table for KIAA1102

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information