HUGE

Gene/Protein Characteristic Table for KIAA1109

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01148
Accession No. :	AB029032
Description :
HUGO Gene Name :
Clone Name :	hh03530s1 [Vector Info]
Flexi ORF Clone :	pF1KA1109
Source :	Human adult brain
Note :	We replaced hh03530, former representative clones for KIAA1109 with hh03530s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 9765 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 503 bp

Genome contig ID gi89161207f_123291013
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TGTTAACTATTATAATAAAGTCACAGTAATGGTTT
Flanking genome sequence
(212344 - 212393)
----+----*----+----*----+----*----+----*----+----*
AAGTCTGTAGTAGTTTTTCAATCTTTTTCTCCTTTTTATAATTAATAGAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 f 123391013 123503355 50 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 3086 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_056127	100.0	hypothetical pr...	Homo sapiens
XP_517422	99.8	similar to frag...	Pan troglodytes
XP_001102884	99.3	similar to CG15...	Macaca mulatta
XP_540963	98.4	similar to CG15...	Canis lupus fam...
CAM24476	97.4	novel protein [...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ScanRegExp IPR001969 1437 1448 PS00141 Peptidase aspartic

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR001969	1437	1448	PS00141	Peptidase aspartic

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GACTGGAGAGATTTTATGTGC

Primer_r
: GTCCTAGCATGATGAAAGCCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GACTGGAGAGATTTTATGTGC
Primer_r	: GTCCTAGCATGATGAAAGCCC
PCR product length	: 134 (2.0k) bp
PCR conditions	: 95 °C15 sec62 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	503 bp
Genome contig ID	gi89161207f_123291013
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TGTTAACTATTATAATAAAGTCACAGTAATGGTTT
Flanking genome sequence (212344 - 212393)	----+--------+--------+--------+--------+----* AAGTCTGTAGTAGTTTTTCAATCTTTTTCTCCTTTTTATAATTAATAGAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	f	123391013	123503355	50	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1109

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information