HUGE |
Gene/Protein Characteristic Table for KIAA1109 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01148 |
---|---|
Accession No. : | AB029032 |
Description : | |
HUGO Gene Name : | |
Clone Name : | hh03530s1 [Vector Info] |
Flexi ORF Clone : | pF1KA1109 |
Source : | Human adult brain |
Note : | We replaced hh03530, former representative clones for KIAA1109 with hh03530s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 9765 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 503 bp Genome contig ID gi89161207f_123291013 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
TGTTAACTATTATAATAAAGTCACAGTAATGGTTTFlanking genome sequence
(212344 - 212393) ----+----*----+----*----+----*----+----*----+----*
AAGTCTGTAGTAGTTTTTCAATCTTTTTCTCCTTTTTATAATTAATAGAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 4 f 123391013 123503355 50 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 3086 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GACTGGAGAGATTTTATGTGC | |
: GTCCTAGCATGATGAAAGCCC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 4 |
: GeneBridge 4 | |
: GACTGGAGAGATTTTATGTGC | |
: GTCCTAGCATGATGAAAGCCC | |
: 134 (2.0k) bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |