HUGE |
Gene/Protein Characteristic Table for KIAA1120 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04416 |
---|---|
Accession No. : | AB032946 |
Description : | Voltage-dependent T-type calcium channel subunit alpha-1I. |
HUGO Gene Name : | |
Clone Name : | hg02941 [Vector Info] |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6405 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3329 bp Genome contig ID gi89161203f_38290042 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
AGTGTTGTTTTGAATAAAAGCCCAGAAGCCTATTTFlanking genome sequence
(125641 - 125690) ----+----*----+----*----+----*----+----*----+----*
AAGAATTTCTCCGTGTGTCTCTGCTGTTCTTTCCCCAGCGGGGTGGGTGT
Chr f/r start end exon identity class ContigView(URL based/DAS) 22 f 38390041 38415681 18 99.4 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1024 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TTAGCCCAGATACACATACTC | |
: AGCGCCATCAGCAACTAGGAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 22 |
: GeneBridge 4 | |
: TTAGCCCAGATACACATACTC | |
: AGCGCCATCAGCAACTAGGAG | |
: 209 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |