HUGE

Gene/Protein Characteristic Table for KIAA1134

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04600
Accession No. :	AB032960
Description :	Conserved oligomeric Golgi complex component 6.
HUGO Gene Name :	component of oligomeric golgi complex 6 (COG6)
Clone Name :	hj00883 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5148 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3310 bp

Genome contig ID gi51511729f_39027874
PolyA signal sequence
(AATATA,-22)
+----*----+----*----+----*----+----
AACCAACATTTTAAATATATGGTTAATAAGGTTTT
Flanking genome sequence
(235930 - 235979)
----+----*----+----*----+----*----+----*----+----*
ATATCTGTTGTGGTGTCATTTTTTGGAAATTTTCTATTGTCATAAACAAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 13 f 39127874 39263802 19 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 611 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX08618	100.0	component of ol...	Homo sapiens
CAH72240	100.0	component of ol...	Homo sapiens
Q9Y2V7	100.0	Conserved oligo...	Homo sapiens
BAG57684	100.0	unnamed protein...	Homo sapiens
XP_509639	99.8	component of ol...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR010490 51 609 PF06419 Conserved oligomeric complex COG6

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010490	51	609	PF06419	Conserved oligomeric complex COG6

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTGGCAGAGATAGCATTACGC

Primer_r
: GCTAAGGTCCAGGGTAAGAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 13

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTGGCAGAGATAGCATTACGC
Primer_r	: GCTAAGGTCCAGGGTAAGAGG
PCR product length	: 169 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3310 bp
Genome contig ID	gi51511729f_39027874
PolyA signal sequence (AATATA,-22)	+--------+--------+----*----+---- AACCAACATTTTAAATATATGGTTAATAAGGTTTT
Flanking genome sequence (235930 - 235979)	----+--------+--------+--------+--------+----* ATATCTGTTGTGGTGTCATTTTTTGGAAATTTTCTATTGTCATAAACAAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	13	f	39127874	39263802	19	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA1134

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information