HUGE

Gene/Protein Characteristic Table for KIAA1138

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00748
Accession No. :	AB032964
Description :	RNA exonuclease 1 homolog.
HUGO Gene Name :	REX1, RNA exonuclease 1 homolog (S. cerevisiae) (REXO1)
Clone Name :	hj05928 [Vector Info]
Flexi ORF Clone :	pF1KSDA1138
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4566 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 817 bp

Genome contig ID gi42406306r_1666248
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
CAGGCAGGGACAGAATAAATGTTTGTATGGATTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGATTTTGTGGTGGTCTTGGTCTTGGTGCCTGGTGAGGCCTCTGCATGTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 r 1766248 1799440 16 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1239 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8N1G1	100.0	RNA exonuclease...	Homo sapiens
AAH32244	99.9	REX1, RNA exonu...	Homo sapiens
NP_065746	99.8	transcription e...	Homo sapiens
EAW69451	99.8	REX1, RNA exonu...	Homo sapiens
EAW69450	99.5	REX1, RNA exonu...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000116 406 476 PD005593 High mobility group proteins HMG-I and HMG-Y

HMMPfam IPR013520 1078 1227 PF00929 Exonuclease

HMMSmart IPR006055 1077 1236 SM00479 Exonuclease

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000116	406	476	PD005593	High mobility group proteins HMG-I and HMG-Y
HMMPfam	IPR013520	1078	1227	PF00929	Exonuclease
HMMSmart	IPR006055	1077	1236	SM00479	Exonuclease

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACCATCATCCCTAAGCGAATC

Primer_r
: TCGTTCAGTGCCTTCTCTATG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CATGCCTCTTCCAAAACAGTG
Primer_r	: GTCTCCATCAGCAGCAGTTTC
PCR product length	: 202 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	817 bp
Genome contig ID	gi42406306r_1666248
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CAGGCAGGGACAGAATAAATGTTTGTATGGATTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGATTTTGTGGTGGTCTTGGTCTTGGTGCCTGGTGAGGCCTCTGCATGTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	r	1766248	1799440	16	99.9	Perfect prediction

Primer_f	: ACCATCATCCCTAAGCGAATC
Primer_r	: TCGTTCAGTGCCTTCTCTATG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1138

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information