HUGE

Gene/Protein Characteristic Table for KIAA1160

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00191
Accession No. :	AB032986
Description :	Pre-mRNA-splicing factor ISY1 homolog.
HUGO Gene Name :	ISY1 splicing factor homolog (S. cerevisiae) (ISY1)
Clone Name :	hj01067 [Vector Info]
Flexi ORF Clone :	pF1KA1160
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4869 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3812 bp

Genome contig ID gi89161205r_130189108
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
ACACATTCCTAAACCATTAAACAGATTTCTATAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGCCACTGCGCCCAGGACTGGTTCTCTGATCTTTGAGCCCAGAGGCGGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 r 130289108 130362569 13 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 351 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9ULR0	1.9e-112	100.0	Pre-mRNA-splici...	Homo sapiens
XP_849089	1.2e-106	96.1	similar to CG96...	Canis lupus fam...
XP_001094091	1.9e-101	99.7	similar to CG96...	Macaca mulatta
XP_001488868	6e-93	98.6	similar to ISY1...	Equus caballus
Q69ZQ2	1e-92	98.2	Pre-mRNA-splici...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR009360 21 288 PF06246 Isy1-like splicing

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009360	21	288	PF06246	Isy1-like splicing

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTCAGGATGTTTCAAAGGCTC

Primer_r
: TCTGTGACCCCAAATGGCATG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTCAGGATGTTTCAAAGGCTC
Primer_r	: TCTGTGACCCCAAATGGCATG
PCR product length	: 170 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	3812 bp
Genome contig ID	gi89161205r_130189108
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- ACACATTCCTAAACCATTAAACAGATTTCTATAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGCCACTGCGCCCAGGACTGGTTCTCTGATCTTTGAGCCCAGAGGCGGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	r	130289108	130362569	13	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA1160

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information