HUGE |
Gene/Protein Characteristic Table for KIAA1165 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00753 |
---|---|
Accession No. : | AB032991 |
Description : | NEDD4 family-interacting protein 2. |
HUGO Gene Name : | Nedd4 family interacting protein 2 (NDFIP2) |
Clone Name : | hk01631 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1165 |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4415 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3560 bp Genome contig ID gi51511729f_78853496 PolyA signal sequence
(AATAAA,-29) +----*----+----*----+----*----+----
AATTTTAATAAACAAAATATCATCTTTTTGAAAATFlanking genome sequence
(174717 - 174766) ----+----*----+----*----+----*----+----*----+----*
AATTTATGTTCATTTCTACTTTGTAAAGTATCATTGGTCACCTACGTCAG
Chr f/r start end exon identity class ContigView(URL based/DAS) 13 f 78953496 79028211 8 99.2 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 284 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: AGATGTGGAAGTGTGAACCTG | |
: GCAACCCCAACCTAATTTCAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 13 |
: GeneBridge 4 | |
: AGATGTGGAAGTGTGAACCTG | |
: GCAACCCCAACCTAATTTCAC | |
: 152 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |