| HUGE |
Gene/Protein Characteristic Table for KIAA1176 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK06843 |
|---|---|
| Accession No. : | AB033002 |
| Description : | Solute carrier family 12 member 5. |
| HUGO Gene Name : | solute carrier family 12 (potassium-chloride transporter), member 5 (SLC12A5) |
| Clone Name : | hg02851a [Vector Info] |
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 3305 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 0 bp Genome contig ID gi51511747f_43996993 PolyA signal sequence
(None) +----*----+----*----+----*----+----
TGGACCGGGTGATGCTGGTCCGCGGCGGCGGCCGCFlanking genome sequence
(122636 - 122685) ----+----*----+----*----+----*----+----*----+----*
GAGGTCATCACCATCTACTCCTGAGAACCAGGACCTGCCACCCGGGCCCG
Chr f/r start end exon identity class ContigView(URL based/DAS) 20 f 44091413 44119627 25 99.5 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1101 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : GCAACCCCAAGGAAAGCAGTC | |
| : TTCATGCTCCCTACTTCCCTG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 20 |
| : GeneBridge 4 | |
| : GCAACCCCAAGGAAAGCAGTC | |
| : AAGGAGGACACCATAGGGCTG | |
| : 124 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |