HUGE |
Gene/Protein Characteristic Table for KIAA1181 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK02021 |
---|---|
Accession No. : | AB033007 |
Description : | Endoplasmic reticulum-Golgi intermediate compartment protein 1. |
HUGO Gene Name : | endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 (ERGIC1) |
Clone Name : | hf00712a [Vector Info] |
Flexi ORF Clone : | pF1KA1181 |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2432 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1420 bp Genome contig ID gi51511721f_172093937 PolyA signal sequence
(None) +----*----+----*----+----*----+----
TCCAGTGGAAGGATTTTTAAAATTATCTTATGGATFlanking genome sequence
(217910 - 217959) ----+----*----+----*----+----*----+----*----+----*
AGCTCAAGTCTCTGCCATTTGTAATTTTTGGCTCTAAGCTCCGATTGGAG
Chr f/r start end exon identity class ContigView(URL based/DAS) 5 f 172193884 172311845 10 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 336 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TAATCATGCAGCCTCTCAGAC | |
: ATGGAGGAGCACAGTGTCAAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 5 |
: GeneBridge 4 | |
: TAATCATGCAGCCTCTCAGAC | |
: ATGGAGGAGCACAGTGTCAAG | |
: 174 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |