HUGE

Gene/Protein Characteristic Table for KIAA1203

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07314
Accession No. :	AB033029
Description :	Ubiquitin carboxyl-terminal hydrolase 31.
HUGO Gene Name :	ubiquitin specific peptidase 31 (USP31)
Clone Name :	fg03361 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 6111 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3927 bp

Genome contig ID gi51511732r_22882940
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TCATAAGCACAGTTTCAATAAAACACGTATTCTGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGGTGCGTGGAACTTTGTATTATTTGTAGTTGAGAAAGGCAAACTTTGCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 r 22982940 23001334 5 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 727 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW55836	1.7e-203	100.0	ubiquitin speci...	Homo sapiens
EAW55835	1.9e-203	100.0	ubiquitin speci...	Homo sapiens
CAE51935	2.2e-203	100.0	ubiquitin-speci...	Homo sapiens
Q70CQ4	2.2e-203	100.0	Ubiquitin carbo...	Homo sapiens
XP_001087999	1.7e-198	97.1	similar to ubiq...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001394 2 137 PF00443 Peptidase C19

ProfileScan IPR001394 1 141 PS50235 Peptidase C19

ScanRegExp IPR001394 82 99 PS00973 Peptidase C19

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001394	2	137	PF00443	Peptidase C19
ProfileScan	IPR001394	1	141	PS50235	Peptidase C19
ScanRegExp	IPR001394	82	99	PS00973	Peptidase C19

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CACATAGAGGGGCATCAGACG

Primer_r
: GAAACTGTGCTTATGACTTGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3927 bp
Genome contig ID	gi51511732r_22882940
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TCATAAGCACAGTTTCAATAAAACACGTATTCTGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGGTGCGTGGAACTTTGTATTATTTGTAGTTGAGAAAGGCAAACTTTGCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	r	22982940	23001334	5	99.1	Perfect prediction

Primer_f	: CACATAGAGGGGCATCAGACG
Primer_r	: GAAACTGTGCTTATGACTTGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1203

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information