HUGE |
Gene/Protein Characteristic Table for KIAA1205 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00766 |
---|---|
Accession No. : | AB033031 |
Description : | Proline-rich protein 12. |
HUGO Gene Name : | |
Clone Name : | fg03511a [Vector Info] |
Flexi ORF Clone : | pF1KSDA1205
![]() |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4470 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 816 bp Genome contig ID gi42406306f_54691915 PolyA signal sequence
(None) +----*----+----*----+----*----+----
AACCAGCCAAACGAAAACCCAACGGCAAACACTTTFlanking genome sequence
(129594 - 129643) ----+----*----+----*----+----*----+----*----+----*
ACCGGCAGGCTGGAGTGCCTCTGTCCTGCGGCGCTGGAGTGGGTGGCAGT
Chr f/r start end exon identity class ContigView(URL based/DAS) 19 f 54790585 54821507 12 98.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1217 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: | |
: | |
: °C |
RH mapping information |
Description | |
---|---|---|
: 19 |
: GeneBridge 4 | |
: ACTGCCCATCCCCCATTGTTG | |
: AGCAAGAGACAAAGGGTAGTG | |
: 118 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |