HUGE

Gene/Protein Characteristic Table for KIAA1205

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00766
Accession No. :	AB033031
Description :	Proline-rich protein 12.
HUGO Gene Name :
Clone Name :	fg03511a [Vector Info]
Flexi ORF Clone :	pF1KSDA1205
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4470 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 816 bp

Genome contig ID gi42406306f_54691915
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AACCAGCCAAACGAAAACCCAACGGCAAACACTTT
Flanking genome sequence
(129594 - 129643)
----+----*----+----*----+----*----+----*----+----*
ACCGGCAGGCTGGAGTGCCTCTGTCCTGCGGCGCTGGAGTGGGTGGCAGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 54790585 54821507 12 98.9 Perfect prediction

Features of the protein sequence	Description

Length: 1217 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9ULL5	100.0	Proline-rich pr...	Homo sapiens
NP_065770	99.3	proline rich 12...	Homo sapiens
EAW52505	99.7	hCG2045936 [Hom...	Homo sapiens
XP_541492	94.3	similar to CG17...	Canis lupus fam...
XP_608073	92.3	similar to prol...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000637 349 361 PF02178 HMG-I and HMG-Y

IPR000637 383 395 PF02178 HMG-I and HMG-Y

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000637	349	361	PF02178	HMG-I and HMG-Y
IPR000637	383	395	PF02178	HMG-I and HMG-Y

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
:

Primer_r
:

PCR conditions
: °C sec °C sec cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ACTGCCCATCCCCCATTGTTG
Primer_r	: AGCAAGAGACAAAGGGTAGTG
PCR product length	: 118 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	816 bp
Genome contig ID	gi42406306f_54691915
PolyA signal sequence (None)	+--------+--------+----*----+---- AACCAGCCAAACGAAAACCCAACGGCAAACACTTT
Flanking genome sequence (129594 - 129643)	----+--------+--------+--------+--------+----* ACCGGCAGGCTGGAGTGCCTCTGTCCTGCGGCGCTGGAGTGGGTGGCAGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	54790585	54821507	12	98.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA1205

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information