HUGE

Gene/Protein Characteristic Table for KIAA1219

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK01627
Accession No. :	AB033045
Description :	K1219_HUMAN Isoform 4 of Q86X10 - Homo sapiens.
HUGO Gene Name :
Clone Name :	ef03859 [Vector Info]
Flexi ORF Clone :	pF1KSDA1219
Source :
Note :	We replaced fh03044 and bg00043, former representative clones for KIAA1219 with ef03859. (2002/5/10,2002/5/10)

Features of the cloned DNA sequence	Description

Length: 8654 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3894 bp

Genome contig ID gi51511747f_36434873
PolyA signal sequence
(ATTAAA,-29)
+----*----+----*----+----*----+----
TAGTCAATTAAATTTTAAGGAGATTCTTATCTAAT
Flanking genome sequence
(206045 - 206094)
----+----*----+----*----+----*----+----*----+----*
AACTTTGTGTGTGCTTTTGGATACAGGCTGAGGCTTTACTCCTACACTGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 f 36534873 36640916 30 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1534 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_808326	97.3	hypothetical pr...	Mus musculus
CAM14581	97.1	novel protein [...	Mus musculus
EDL06268	96.1	mCG15732 [Mus m...	Mus musculus
CAH65287	92.0	hypothetical pr...	Gallus gallus
CAM27457	99.7	RP5-1100H13.1 [...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan IPR000331 1188 1432 PS50085 Rap/ran-GAP

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR000331	1188	1432	PS50085	Rap/ran-GAP

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3894 bp
Genome contig ID	gi51511747f_36434873
PolyA signal sequence (ATTAAA,-29)	+--------+--------+----*----+---- TAGTCAATTAAATTTTAAGGAGATTCTTATCTAAT
Flanking genome sequence (206045 - 206094)	----+--------+--------+--------+--------+----* AACTTTGTGTGTGCTTTTGGATACAGGCTGAGGCTTTACTCCTACACTGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	f	36534873	36640916	30	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA1219

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information