HUGE |
Gene/Protein Characteristic Table for KIAA1224 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK07431 |
---|---|
Accession No. : | AB033050 |
Description : | Zinc finger MIZ domain-containing protein 1. |
HUGO Gene Name : | zinc finger, MIZ-type containing 1 (ZMIZ1) |
Clone Name : | fh02652 [Vector Info] |
Source : | Human fetal brain |
Note : | We replaced fh03906, former representative clones for KIAA1224 with fh02652. (2002/12/27) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4860 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1865 bp Genome contig ID gi89161187f_80573431 PolyA signal sequence
(None) +----*----+----*----+----*----+----
TTTGTGAATATTTTAGTATCGTCTTTGATAATATTFlanking genome sequence None
Chr f/r start end exon identity class ContigView(URL based/DAS) 10 f 80673431 80744470 20 99.6 Terminal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 997 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CCACCCCATGCAGGAAACTAT | |
: CTCCCTACCCCTCTGTTCTGA | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 10 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |