HUGE

Gene/Protein Characteristic Table for KIAA1227

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00773
Accession No. :	AB033053
Description :	Zinc finger protein 295.
HUGO Gene Name :	zinc finger protein 295 (ZNF295)
Clone Name :	fh04710 [Vector Info]
Flexi ORF Clone :	pF1KSDA1227
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5561 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2257 bp

Genome contig ID gi51511750r_42181816
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
ATATAAGATTTCAAATAAAATTTTGAACCAAAAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTTATAATGCCGTTCTGGTTTTTCTATTACTTTTTATACTGTACTTTAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 21 r 42281816 42303519 2 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 1069 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9ULJ3	100.0	Zinc finger pro...	Homo sapiens
AAH63290	99.9	Zinc finger pro...	Homo sapiens
XP_514917	99.7	zinc finger pro...	Pan troglodytes
XP_001106447	99.2	similar to zinc...	Macaca mulatta
XP_001493007	90.1	zinc finger pro...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013069 23 129 PF00651 BTB/POZ

IPR007087 549 572 PF00096 Zinc finger

IPR007087 673 695 PF00096 Zinc finger

IPR007087 912 935 PF00096 Zinc finger

IPR007087 940 962 PF00096 Zinc finger

IPR007087 1046 1068 PF00096 Zinc finger

HMMSmart IPR000210 33 129 SM00225 BTB/POZ-like

IPR015880 549 572 SM00355 Zinc finger

IPR015880 578 601 SM00355 Zinc finger

IPR015880 673 695 SM00355 Zinc finger

IPR015880 725 745 SM00355 Zinc finger

IPR015880 751 771 SM00355 Zinc finger

IPR015880 778 801 SM00355 Zinc finger

IPR015880 912 932 SM00355 Zinc finger

IPR015880 940 962 SM00355 Zinc finger

IPR015880 1046 1068 SM00355 Zinc finger

ProfileScan IPR000210 33 99 PS50097 BTB/POZ-like

IPR007087 549 577 PS50157 Zinc finger

IPR007087 673 700 PS50157 Zinc finger

IPR007087 778 806 PS50157 Zinc finger

IPR007087 912 939 PS50157 Zinc finger

IPR007087 940 967 PS50157 Zinc finger

IPR007087 1046 1069 PS50157 Zinc finger

ScanRegExp IPR007087 551 572 PS00028 Zinc finger

IPR007087 580 601 PS00028 Zinc finger

IPR007087 675 695 PS00028 Zinc finger

IPR007087 780 801 PS00028 Zinc finger

IPR007087 942 962 PS00028 Zinc finger

IPR007087 1048 1068 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	23	129	PF00651	BTB/POZ
IPR007087	549	572	PF00096	Zinc finger
IPR007087	673	695	PF00096	Zinc finger
IPR007087	912	935	PF00096	Zinc finger
IPR007087	940	962	PF00096	Zinc finger
IPR007087	1046	1068	PF00096	Zinc finger
HMMSmart	IPR000210	33	129	SM00225	BTB/POZ-like
IPR015880	549	572	SM00355	Zinc finger
IPR015880	578	601	SM00355	Zinc finger
IPR015880	673	695	SM00355	Zinc finger
IPR015880	725	745	SM00355	Zinc finger
IPR015880	751	771	SM00355	Zinc finger
IPR015880	778	801	SM00355	Zinc finger
IPR015880	912	932	SM00355	Zinc finger
IPR015880	940	962	SM00355	Zinc finger
IPR015880	1046	1068	SM00355	Zinc finger
ProfileScan	IPR000210	33	99	PS50097	BTB/POZ-like
IPR007087	549	577	PS50157	Zinc finger
IPR007087	673	700	PS50157	Zinc finger
IPR007087	778	806	PS50157	Zinc finger
IPR007087	912	939	PS50157	Zinc finger
IPR007087	940	967	PS50157	Zinc finger
IPR007087	1046	1069	PS50157	Zinc finger
ScanRegExp	IPR007087	551	572	PS00028	Zinc finger
IPR007087	580	601	PS00028	Zinc finger
IPR007087	675	695	PS00028	Zinc finger
IPR007087	780	801	PS00028	Zinc finger
IPR007087	942	962	PS00028	Zinc finger
IPR007087	1048	1068	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTACTTCCAGATAGAGCAGAG

Primer_r
: AGCAATGATGTAGAGAATGGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 21

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TTACTTCCAGATAGAGCAGAG
Primer_r	: AGCAATGATGTAGAGAATGGC
PCR product length	: 175 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2257 bp
Genome contig ID	gi51511750r_42181816
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- ATATAAGATTTCAAATAAAATTTTGAACCAAAAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTATAATGCCGTTCTGGTTTTTCTATTACTTTTTATACTGTACTTTAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	21	r	42281816	42303519	2	99.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1227

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information