HUGE

Gene/Protein Characteristic Table for KIAA1237

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05411
Accession No. :	AB033063
Description :	Protein HEG homolog 1 precursor.
HUGO Gene Name :	HEG homolog 1 (zebrafish) (HEG1)
Clone Name :	fh09696s1 [Vector Info]
Flexi ORF Clone :	pF1KA1237
Source :	Human fetal brain
Note :	We replaced fh09696, former representative clones for KIAA1237 with fh09696s1. (2003/8/28)

Features of the cloned DNA sequence	Description

Length: 6985 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3176 bp

Genome contig ID gi89161205r_126069011
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTTTAAGAAGTAACCAAATTAGTGACGTGAAATGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAATGCTGACTACCCTTTTGAAAATGTGCTTTCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 r 126169011 126231001 16 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 1268 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9ULI3	0	99.8	Protein HEG hom...	Homo sapiens
BAG10442	0	92.4	HEG homolog 1 [...	synthetic construct
XP_589074	0	65.8	similar to Prot...	Bos taurus
XP_516708	0	98.4	HEG homolog 1 [...	Pan troglodytes
XP_545138	3.4e-164	62.5	similar to HEG ...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006209 876 909 PF00008 EGF-like

IPR013091 912 949 PF07645 EGF calcium-binding

HMMSmart IPR001881 872 910 SM00179 EGF-like calcium-binding

IPR006210 875 910 SM00181 EGF

IPR001881 912 950 SM00179 EGF-like calcium-binding

IPR006210 915 950 SM00181 EGF

IPR006210 1070 1118 SM00181 EGF

ProfileScan IPR000742 872 910 PS50026 EGF-like

IPR000742 912 950 PS50026 EGF-like

ScanRegExp IPR013032 898 909 PS00022 EGF-like region

IPR001881 905 936 PS01187 EGF-like calcium-binding

IPR000152 927 938 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 936 949 PS01186 EGF-like region

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006209	876	909	PF00008	EGF-like
IPR013091	912	949	PF07645	EGF calcium-binding
HMMSmart	IPR001881	872	910	SM00179	EGF-like calcium-binding
IPR006210	875	910	SM00181	EGF
IPR001881	912	950	SM00179	EGF-like calcium-binding
IPR006210	915	950	SM00181	EGF
IPR006210	1070	1118	SM00181	EGF
ProfileScan	IPR000742	872	910	PS50026	EGF-like
IPR000742	912	950	PS50026	EGF-like
ScanRegExp	IPR013032	898	909	PS00022	EGF-like region
IPR001881	905	936	PS01187	EGF-like calcium-binding
IPR000152	927	938	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	936	949	PS01186	EGF-like region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 1136 ITVVIAAAGGGLLLILGIALIVT 1158 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1136	ITVVIAAAGGGLLLILGIALIVT	1158	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCGTATGGAGTGGATTAAGAG

Primer_r
: CTGGAAACTGTGGAGACTGTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3176 bp
Genome contig ID	gi89161205r_126069011
PolyA signal sequence (None)	+--------+--------+----*----+---- TTTTAAGAAGTAACCAAATTAGTGACGTGAAATGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAATGCTGACTACCCTTTTGAAAATGTGCTTTCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	r	126169011	126231001	16	99.3	Perfect prediction

Primer_f	: CCGTATGGAGTGGATTAAGAG
Primer_r	: CTGGAAACTGTGGAGACTGTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1237

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information