HUGE |
Gene/Protein Characteristic Table for KIAA1244 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00777 |
---|---|
Accession No. : | AB033070 |
Description : | Brefeldin A-inhibited guanine nucleotide-exchange protein 3. |
HUGO Gene Name : | |
Clone Name : | hf00438s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1244
![]() |
Source : | Human adult brain |
Note : | We replaced hf00438, former representative clones for KIAA1244 with hf00438s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7932 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2313 bp Genome contig ID gi89161210f_138518411 PolyA signal sequence
(None) +----*----+----*----+----*----+----
ACTCCAGACTGGGTGACAAGAGTGAAACTCCATCTFlanking genome sequence
(183220 - 183269) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAGTGAATACTGTATCCCAAAGTATGTTAGTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 6 f 138618411 138701629 25 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1872 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TTGAGGAGCTGAAGGATGGGG | |
: TGTCAAGGCTCCTCTCGTTCC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 6 |
: GeneBridge 4 | |
: TTGAGGAGCTGAAGGATGGGG | |
: TGTCAAGGCTCCTCTCGTTCC | |
: 135 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |