HUGE |
Gene/Protein Characteristic Table for KIAA1254 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00206 |
---|---|
Accession No. : | AB033080 |
Description : | cell cycle progression 1 isoform 1. |
HUGO Gene Name : | cell cycle progression 1 (CCPG1) |
Clone Name : | hh14357s1 [Vector Info] |
Flexi ORF Clone : | pF1KA1254 |
Source : | Human adult brain |
Note : | We replaced hh14357, former representative clones for KIAA1254 with hh14357s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6213 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3855 bp Genome contig ID gi51511731r_53335134 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
TATCGTGGAAGAAACAATAAAACTACACCATGAGGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAACTAAAGGTCTTTATTTAAAATCTGGCATTGTATTAACATGTAATTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 15 r 53435134 53487785 8 99.1 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 758 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: AATCTGAAGACCGGCTAGTTG | |
: CTGTTGACGCTTCTGAATCTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 15 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |