HUGE |
Gene/Protein Characteristic Table for KIAA1265 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00208 |
---|---|
Accession No. : | AB033091 |
Description : | solute carrier family 39 (zinc transporter), member 10. |
HUGO Gene Name : | solute carrier family 39 (zinc transporter), member 10 (SLC39A10) |
Clone Name : | hj04493 [Vector Info] |
Flexi ORF Clone : | pF1KA1265 |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5231 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2657 bp Genome contig ID gi89161199f_196130184 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
TATGGAACTCCTCCAAAATAAAGTTACTCAAAGAGFlanking genome sequence
(180481 - 180530) ----+----*----+----*----+----*----+----*----+----*
AGCAAATATGCCAGTGTGTTTTCTTTAGTCTTTATTTCAGAACATTTCCT
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 f 196230184 196310663 10 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 835 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CATCTCATTGCTTGGCCCTTC | |
: AATGCAGAATCCTACCGTGGG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 2 |
: GeneBridge 4 | |
: CATCTCATTGCTTGGCCCTTC | |
: AATGCAGAATCCTACCGTGGG | |
: 165 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |