HUGE

Gene/Protein Characteristic Table for KIAA1269

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00791
Accession No. :	AB033095
Description :	Glucocorticoid modulatory element-binding protein 2.
HUGO Gene Name :	glucocorticoid modulatory element binding protein 2 (GMEB2)
Clone Name :	hk04070 [Vector Info]
Flexi ORF Clone :	pF1KSDA1269
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4160 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2487 bp

Genome contig ID gi51511747r_61589399
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TACTTTGATTTAAAATAAAAACAATTTTCATAGTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TGAGTGTCTATCTCTTGGAATGAAGTGTGGAGAGAAATCAAGTCTATAAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 r 61689399 61728775 10 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 531 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG10021	8.1e-186	100.0	glucocorticoid ...	synthetic construct
Q9UKD1	5.7e-185	99.6	Glucocorticoid ...	Homo sapiens
XP_530318	1.5e-182	97.9	glucocorticoid ...	Pan troglodytes
EDL88735	5e-175	94.5	glucocorticoid ...	Rattus norvegicus
XP_001492891	2.1e-174	93.7	similar to Gluc...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000770 82 164 PF01342 SAND

HMMSmart IPR000770 91 164 SM00258 SAND

ProfileScan IPR000770 82 164 PS50864 SAND

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000770	82	164	PF01342	SAND
HMMSmart	IPR000770	91	164	SM00258	SAND
ProfileScan	IPR000770	82	164	PS50864	SAND

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGGGAAGGTTGTTGTCAGCAC

Primer_r
: TGTACGTGGTTGAGAAGGTCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GGGGAAGGTTGTTGTCAGCAC
Primer_r	: TGTACGTGGTTGAGAAGGTCC
PCR product length	: 139 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2487 bp
Genome contig ID	gi51511747r_61589399
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TACTTTGATTTAAAATAAAAACAATTTTCATAGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGAGTGTCTATCTCTTGGAATGAAGTGTGGAGAGAAATCAAGTCTATAAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	r	61689399	61728775	10	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA1269

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information