HUGE

Gene/Protein Characteristic Table for KIAA1274

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00792
Accession No. :	AB033100
Description :	Paladin.
HUGO Gene Name :
Clone Name :	hk09836s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA1274
Source :	Human adult brain
Note :	We replaced hk09836, former representative clones for KIAA1274 with hk09836s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4569 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1719 bp

Genome contig ID gi89161187f_71808583
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
ACAGAGCTTTTAAGCATTAAAAACAGCTAAATGTG
Flanking genome sequence
(189630 - 189679)
----+----*----+----*----+----*----+----*----+----*
AGTGCACCTGGCTGCTAATATGTCTTTAGTGTCAGACAGACGTTCTAGAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 f 71908583 71998211 20 99.5 Terminal No-hit

Features of the protein sequence	Description

Length: 861 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_603024	84.7	similar to Pala...	Bos taurus
NP_001029300	82.4	paladin [Rattus...	Rattus norvegicus
AAI37696	81.3	X99384 protein ...	Mus musculus
BAC40433	81.3	unnamed protein...	Mus musculus
AAI44848	81.1	CDNA sequence X...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMSmart IPR003595 267 389 SM00404 Protein-tyrosine phosphatase

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR003595	267	389	SM00404	Protein-tyrosine phosphatase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGTCCCAGTGAGCCAAGCAAG

Primer_r
: GTGCCATGTTTGCGTTGAGCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GTGCCATGTTTGCGTTGAGCC
Primer_r	: GGTCCCAGTGAGCCAAGCAAG
PCR product length	: 112 bp
PCR conditions	: 95 °C15 sec68 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1719 bp
Genome contig ID	gi89161187f_71808583
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- ACAGAGCTTTTAAGCATTAAAAACAGCTAAATGTG
Flanking genome sequence (189630 - 189679)	----+--------+--------+--------+--------+----* AGTGCACCTGGCTGCTAATATGTCTTTAGTGTCAGACAGACGTTCTAGAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	f	71908583	71998211	20	99.5	Terminal No-hit

Gene/Protein Characteristic Table for KIAA1274

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information